- Trang Chủ
- Nông nghiệp
- Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis ở lợn nuôi tại tỉnh Hưng Yên
Xem mẫu
- Vietnam J. Agri. Sci. 2022, Vol. 20, No. 7: 911-919 Tạp chí Khoa học Nông nghiệp Việt Nam 2022, 20(7): 911-919
www.vnua.edu.vn
Trương Quang Lâm*, Nguyễn Thị Thu Hương,
Nguyễn Thị Lan, Đào Lê Anh, Lê Thị Trang, Vũ Thị Ánh
Phòng Thí nghiệm trọng điểm Công nghệ sinh học Thú y,
Khoa Thú y, Học viện Nông nghiệp Việt Nam
*
Tác giả liên hệ: tqlam@vnua.edu.vn
Ngày nhận bài: 12.10.2021 Ngày chấp nhận đăng: 05.07.2022
TÓM TẮT
Mục tiêu của nghiên cứu này nhằm xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis từ lợn nghi nhiễm bệnh
thuộc địa bàn huyện Khoái Châu, Văn Giang, Yên Mỹ, tỉnh Hưng Yên. Tổng số 52 mẫu bệnh phẩm của lợn nghi
nhiễm bệnh đã được sử dụng để xác định tỷ lệ nhiễm vi khuẩn M. hyorhinis bằng phương pháp PCR. Kết quả nghiên
cứu cho thấy tỷ lệ nhiễm vi khuẩn M. hyorhinis ở lợn nghi mắc bệnh tại 3 huyện ở tỉnh Hưng Yên tương đối cao
chiếm tỷ lệ 26,92%, trong đó tỷ lệ nhiễm ở Khoái Châu 31,82%, Văn Giang 25,00% và Yên Mỹ 21,43%. Tỷ lệ nhiễm
vi khuẩn M. hyorhinis trên lợn ở 5-10 tuần tuổi là cao nhất với 29,41% và tiếp theo là lợn > 10 tuần tuổi 28,57%,
lợn < 5 tuần tuổi tỷ lệ nhiễm thấp nhất 21,43%. Nghiên cứu đã xác định tỷ lệ đồng nhiễm M. hyorhinis với
M. hyopneumoniae chiếm 28,57%, H. parasuis 35,71% và S. suis 21,43%. Kết quả so sánh bệnh tích đại thể, sử dụng
phương pháp PCR cho thấy lợn bệnh dương tính với vi khuẩn M. hyorhinis có đặc điểm bệnh lý điển hình với viêm
dính màng ngoài phủ fibrin.
Từ khóa: M. hyorhinis, tỷ lệ nhiễm, PCR, Hưng Yên.
Exploring Prevalence of Mycoplasma hyorhinis Infection
by PCR Method in Pigs Raised in Hung Yen Province
ABSTRACT
The aim of this study was to determine the infection rate of Mycoplasma hyorhinis from suspected pigs in Khoai
Chau, Van Giang, and Yen My districts of Hung Yen province. A total of 52 clinical samples of suspected pigs were
used to determine the infection rate of M. hyorhinis by using the PCR method. The results showed that the infection
rate of M. hyorhinis in 3 districts in Hung Yen province was relatively high at 26.92%, in which infection rate was
recorded in Khoai Chau with 31.82%, Van Giang 25.00% and Yen My 21.43%. The rate of infection with M. hyorhinis
in pigs at 5-10 weeks of age was the highest at 29.41% and was similar to pigs >10 weeks old 28.57%, while
pigs < 5 weeks old showed lowest infection rate 21.43%. Research also determined that the rate of co-infection of
M. hyorhinis with M. hyopneumoniae accounted for 28.57%, H. parasuis 35.71% and S. suis 21.43%. Comparison of
macroscopic findings and PCR results showed that pigs infected with M. hyorhinis exhibited the main pathological
feature with a severe fibrinous pericarditis.
Keywords: M. hyorhinis infection in pigs, prevalence, PCR, Hung Yen province.
911
- Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis ở lợn nuôi tại tỉnh Hưng Yên
912
- Trương Quang Lâm, Nguyễn Thị Thu Hương, Nguyễn Thị Lan, Đào Lê Anh, Lê Thị Trang, Vũ Thị Ánh
µ
µ µ µ
µ
Phát hiện vi khuẩn Trình tự mồi Sản phẩm (bp) Tài liệu tham khảo
M. hyopneumoniae ACTAGATAGGAAATGCTCTAG 430 Barate & cs., 2012
ATACTACTCAGGCGGATCATTTAAC
H. parasuis GTGATGAGGAAGGGTGGTGT 821 Oliveira S & cs., 2001
GGCTTCGTCACCCTCTGTA
S. suis GCAGCGTATTCTGTCAAACG 688 Okwumabua & cs., 2003
CCATGGACAGATAAAGATGG
913
- Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis ở lợn nuôi tại tỉnh Hưng Yên
Phát hiện Chu trình nhiệt của phản ứng PCR
vi khuẩn Tiền biến tính Biến tính Bắt cặp Tổng hợp Kéo dài
M. hyopneumoniae 94C/3 phút 94C/30 giây 50C/45 giây 72C/1 phút 72C/7 phút
1 chu kỳ 35 chu kỳ 1 chu kỳ
H. parasuis 94C/5 phút 94C/30 giây 56C/1 phút 72C/90 giây 72C/7 phút
1 chu kỳ 30 chu kỳ 1 chu kỳ
S. suis 94C/5 phút 94C/30 giây 57,3C/1phút 72C/90 giây 72C/6 phút
1 chu kỳ 30 chu kỳ 1 chu kỳ
Huyện Số lợn kiểm tra Số lợn dương tính Tỷ lệ (%)
Khoái Châu 22 7 31,82
Văn Giang 16 4 25,00
Yên Mỹ 14 3 21,43
Tổng 52 14 26,92
914
- Trương Quang Lâm, Nguyễn Thị Thu Hương, Nguyễn Thị Lan, Đào Lê Anh, Lê Thị Trang, Vũ Thị Ánh
Đối tượng lợn theo dõi
Số lợn kiểm tra Số lợn dương tính Tỷ lệ (%)
(tuần tuổi)
10 21 6 28,57
Tổng 52 14 26,92
915
- Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis ở lợn nuôi tại tỉnh Hưng Yên
Đối tượng lợn theo dõi
M. hyorhinis M. hyopneumoniae H. parasuis S. suis
(tuần tuổi)
10 6 1/6 2/6 1/6
(16,67%) (33,33%) (16,67%)
Tổng 14 4/14 5/14 3/14
(28,57%) (35,71%) (21,43%)
916
- Trương Quang Lâm, Nguyễn Thị Thu Hương, Nguyễn Thị Lan, Đào Lê Anh, Lê Thị Trang, Vũ Thị Ánh
917
- Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis ở lợn nuôi tại tỉnh Hưng Yên
Abhijit K. Barate, Hwi-Young Lee, Hye-Won Jeong,
Lam Quang Truong, Hong-Gu Joo & Tae-Wook
Hahn (2012). An improved multiplex PCR for
diagnosis and differentiation of Mycoplasma
hyopneumoniae and Mycoplasma hyorhinis. Korean
Journal of Veterinary Research. 52(1):39-43.
Boetner A.G., Binder M. & Bille-Hansen V. (1987).
Streptococcus suis infections in Danish pigs and
experimental infection with Streptococcus suis
serotype 7. Acta Pathol Microbiol Immunol Scand
B. 95: 233-239.
Caron J., Ouardani M. & Dea S. (2000). Diagnosis and
differentiation of Mycoplasma hyopneumoniae and
Mycoplasma hyorhinis infections in pigs by PCR
amplification of the p36 and p46 genes. J Clin
Microbiol. 38: 1390-1396.
918
- Trương Quang Lâm, Nguyễn Thị Thu Hương, Nguyễn Thị Lan, Đào Lê Anh, Lê Thị Trang, Vũ Thị Ánh
Gois M., Kuksa F. & Sisak F. (1977). Experimental and pathological lesions of Enzootic Pneumonia.
infection of gnotobiotic piglets with Mycoplasma Vet Microbiol. 203: 1-5.
hyorhinis and Bordetella bronchiseptica. Zentralbl Miranda-Morales R.E., Trejo V.R., López-Cerino
Veterinarmed. B24: 89-96. L.E., Carrillo-Casas E.M., Sarmiento-Silva
Huỳnh Thị Mỹ Lệ, Tạ Thị Kim Chung, Vũ Thị Ngọc, R.E., Trujillo-Ortega M.E., Figueroa R.B.
Cao Thị Bích Phượng & Chu Thị Thanh Hương & Trigo-Tavera F.J. (2020). Frequency of
(2018). Ứng dụng phản ứng Multiplex Nested PCR M. hyopneumoniae, M. hyorhinis and
để phát hiện Haemophilus parasuis, Mycoplasma M. hyosynoviae in nasal and lung samples from
hyorhinis và Streptococcus suis gây bệnh viêm đa pigs with symptoms of porcine enzootic
thanh mạc ở lợn. Kỷ yếu Hội thảo khoa học nữ cán pneumonia. Revista Mexicana de Ciencias
bộ viên chức. Nhà xuất bản Học viện Nông nghiệp. Pecuarias. 11(4): 946-960.
tr. 167-175.
Morita T., Ohiwa S., Shimada A., Kazama S.,
Kang I., Kim D., Han K., Seo H.W., Oh Y., Park C., Yagihashi T. & Umemura T. (1999). Intranasally
Lee J., Gottschalk M. & Chae C. (2012). inoculated Mycoplasma hyorhinis causes
Optimized protocol for multiplex nested eustachitis in pigs. Vet 82 Pathol. 36: 174-178.
polymerase chain reaction to detect and
differentiate Haemophilus parasuis, Streptococcus Morita T., Sasaki A., Kaji N., Shimada A., Kazama S.,
suis, and Mycoplasma hyorhinis in formalin-fixed, Yagihashi T., Umemura T. (1998). Induction of
paraffin-embedded tissues from pigs with temporary otitis media in specific-pathogen-free
polyserositis. Canadian Journal of Veterinary pigs by intratympanic inoculation of Mycoplasma
Research. 76: 195-200. hyorhinis. Am J Vet Res. 59: 869-873.
Lee J.A., Oh Y.R., Hwang M.A., Lee J.B., Park S.Y., Okwumabua O., O'Connor M. & Shull E. (2003). A
Song C.S. & Lee S.W. (2016). Mycoplasma polymerase chain reaction (PCR) assay specific for
hyorhinis is a potential pathogen of porcine Streptococcus suis based on the gene encoding the
respiratory disease complex that aggravates glutamate dehydrogenase. FEMS Microbiol Lett.
pneumonia caused by porcine reproductive and 218(1): 79-84.
respiratory syndrome virus. Veterinary Oliveira S., Galina L. & Pijoan C. (2001).
Immunology and Immunopathology. 177: 48-51. Development of a PCR test to diagnose
Lin J.H., Chen S.P., Yeh K.S. & Weng C.N. (2006). Haemophilus parasuis infections. J Vet. Diagn
Mycoplasma hyorhinis in Taiwan: Diagnosis and Invest. 13(6): 495-501.
isolation of swine pneumonia pathogen. Vet Pallarés F.J., Halbur P.G., Schmitt C.S., Roth J.A.,
Microbiol. 115: 111-116. Opriessnig T., Thomas P.J., Kinyon J.M., Murphy
Lobo E., Poveda C., Gupta R., Suarez A., Hernández D., Frank D.E. & Hoffman L.J. (2003).
Y., Ramírez A. & Poveda J.B. (2011). Comparison of experimental models for
Mycoplasmas hyorhinis in different regions of Streptococcus suis infection of conventional
Cuba. Diagnosis. Braz J Microbiol. 42: 721-725. pigs. Canadian Journal of Veterinary Research.
Luehrs A., Siegenthaler S., Grützner N., Grosse 67: 225-228.
Beilage E., Kuhnert P. & Nathues H. (2017). Riley M.G., Russell E.G. & Callinan R.B. (1977).
Occurrence of Mycoplasma hyorhinis infections in Haemophilus parasuis infection in swine. J Am
fattening pigs and association with clinical signs Vet Med Assoc. 171(7):649-51.
919
nguon tai.lieu . vn