Xem mẫu

  1. Vietnam J. Agri. Sci. 2022, Vol. 20, No. 7: 911-919 Tạp chí Khoa học Nông nghiệp Việt Nam 2022, 20(7): 911-919 www.vnua.edu.vn Trương Quang Lâm*, Nguyễn Thị Thu Hương, Nguyễn Thị Lan, Đào Lê Anh, Lê Thị Trang, Vũ Thị Ánh Phòng Thí nghiệm trọng điểm Công nghệ sinh học Thú y, Khoa Thú y, Học viện Nông nghiệp Việt Nam * Tác giả liên hệ: tqlam@vnua.edu.vn Ngày nhận bài: 12.10.2021 Ngày chấp nhận đăng: 05.07.2022 TÓM TẮT Mục tiêu của nghiên cứu này nhằm xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis từ lợn nghi nhiễm bệnh thuộc địa bàn huyện Khoái Châu, Văn Giang, Yên Mỹ, tỉnh Hưng Yên. Tổng số 52 mẫu bệnh phẩm của lợn nghi nhiễm bệnh đã được sử dụng để xác định tỷ lệ nhiễm vi khuẩn M. hyorhinis bằng phương pháp PCR. Kết quả nghiên cứu cho thấy tỷ lệ nhiễm vi khuẩn M. hyorhinis ở lợn nghi mắc bệnh tại 3 huyện ở tỉnh Hưng Yên tương đối cao chiếm tỷ lệ 26,92%, trong đó tỷ lệ nhiễm ở Khoái Châu 31,82%, Văn Giang 25,00% và Yên Mỹ 21,43%. Tỷ lệ nhiễm vi khuẩn M. hyorhinis trên lợn ở 5-10 tuần tuổi là cao nhất với 29,41% và tiếp theo là lợn > 10 tuần tuổi 28,57%, lợn < 5 tuần tuổi tỷ lệ nhiễm thấp nhất 21,43%. Nghiên cứu đã xác định tỷ lệ đồng nhiễm M. hyorhinis với M. hyopneumoniae chiếm 28,57%, H. parasuis 35,71% và S. suis 21,43%. Kết quả so sánh bệnh tích đại thể, sử dụng phương pháp PCR cho thấy lợn bệnh dương tính với vi khuẩn M. hyorhinis có đặc điểm bệnh lý điển hình với viêm dính màng ngoài phủ fibrin. Từ khóa: M. hyorhinis, tỷ lệ nhiễm, PCR, Hưng Yên. Exploring Prevalence of Mycoplasma hyorhinis Infection by PCR Method in Pigs Raised in Hung Yen Province ABSTRACT The aim of this study was to determine the infection rate of Mycoplasma hyorhinis from suspected pigs in Khoai Chau, Van Giang, and Yen My districts of Hung Yen province. A total of 52 clinical samples of suspected pigs were used to determine the infection rate of M. hyorhinis by using the PCR method. The results showed that the infection rate of M. hyorhinis in 3 districts in Hung Yen province was relatively high at 26.92%, in which infection rate was recorded in Khoai Chau with 31.82%, Van Giang 25.00% and Yen My 21.43%. The rate of infection with M. hyorhinis in pigs at 5-10 weeks of age was the highest at 29.41% and was similar to pigs >10 weeks old 28.57%, while pigs < 5 weeks old showed lowest infection rate 21.43%. Research also determined that the rate of co-infection of M. hyorhinis with M. hyopneumoniae accounted for 28.57%, H. parasuis 35.71% and S. suis 21.43%. Comparison of macroscopic findings and PCR results showed that pigs infected with M. hyorhinis exhibited the main pathological feature with a severe fibrinous pericarditis. Keywords: M. hyorhinis infection in pigs, prevalence, PCR, Hung Yen province. 911
  2. Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis ở lợn nuôi tại tỉnh Hưng Yên  912
  3. Trương Quang Lâm, Nguyễn Thị Thu Hương, Nguyễn Thị Lan, Đào Lê Anh, Lê Thị Trang, Vũ Thị Ánh µ µ µ µ µ      Phát hiện vi khuẩn Trình tự mồi Sản phẩm (bp) Tài liệu tham khảo M. hyopneumoniae ACTAGATAGGAAATGCTCTAG 430 Barate & cs., 2012 ATACTACTCAGGCGGATCATTTAAC H. parasuis GTGATGAGGAAGGGTGGTGT 821 Oliveira S & cs., 2001 GGCTTCGTCACCCTCTGTA S. suis GCAGCGTATTCTGTCAAACG 688 Okwumabua & cs., 2003 CCATGGACAGATAAAGATGG 913
  4. Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis ở lợn nuôi tại tỉnh Hưng Yên Phát hiện Chu trình nhiệt của phản ứng PCR vi khuẩn Tiền biến tính Biến tính Bắt cặp Tổng hợp Kéo dài M. hyopneumoniae 94C/3 phút 94C/30 giây 50C/45 giây 72C/1 phút 72C/7 phút 1 chu kỳ 35 chu kỳ 1 chu kỳ H. parasuis 94C/5 phút 94C/30 giây 56C/1 phút 72C/90 giây 72C/7 phút 1 chu kỳ 30 chu kỳ 1 chu kỳ S. suis 94C/5 phút 94C/30 giây 57,3C/1phút 72C/90 giây 72C/6 phút 1 chu kỳ 30 chu kỳ 1 chu kỳ Huyện Số lợn kiểm tra Số lợn dương tính Tỷ lệ (%) Khoái Châu 22 7 31,82 Văn Giang 16 4 25,00 Yên Mỹ 14 3 21,43 Tổng 52 14 26,92 914
  5. Trương Quang Lâm, Nguyễn Thị Thu Hương, Nguyễn Thị Lan, Đào Lê Anh, Lê Thị Trang, Vũ Thị Ánh Đối tượng lợn theo dõi Số lợn kiểm tra Số lợn dương tính Tỷ lệ (%) (tuần tuổi) 10 21 6 28,57 Tổng 52 14 26,92 915
  6. Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis ở lợn nuôi tại tỉnh Hưng Yên Đối tượng lợn theo dõi M. hyorhinis M. hyopneumoniae H. parasuis S. suis (tuần tuổi) 10 6 1/6 2/6 1/6 (16,67%) (33,33%) (16,67%) Tổng 14 4/14 5/14 3/14 (28,57%) (35,71%) (21,43%) 916
  7. Trương Quang Lâm, Nguyễn Thị Thu Hương, Nguyễn Thị Lan, Đào Lê Anh, Lê Thị Trang, Vũ Thị Ánh 917
  8. Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis ở lợn nuôi tại tỉnh Hưng Yên Abhijit K. Barate, Hwi-Young Lee, Hye-Won Jeong, Lam Quang Truong, Hong-Gu Joo & Tae-Wook Hahn (2012). An improved multiplex PCR for diagnosis and differentiation of Mycoplasma hyopneumoniae and Mycoplasma hyorhinis. Korean Journal of Veterinary Research. 52(1):39-43. Boetner A.G., Binder M. & Bille-Hansen V. (1987). Streptococcus suis infections in Danish pigs and experimental infection with Streptococcus suis serotype 7. Acta Pathol Microbiol Immunol Scand B. 95: 233-239. Caron J., Ouardani M. & Dea S. (2000). Diagnosis and differentiation of Mycoplasma hyopneumoniae and Mycoplasma hyorhinis infections in pigs by PCR amplification of the p36 and p46 genes. J Clin Microbiol. 38: 1390-1396. 918
  9. Trương Quang Lâm, Nguyễn Thị Thu Hương, Nguyễn Thị Lan, Đào Lê Anh, Lê Thị Trang, Vũ Thị Ánh Gois M., Kuksa F. & Sisak F. (1977). Experimental and pathological lesions of Enzootic Pneumonia. infection of gnotobiotic piglets with Mycoplasma Vet Microbiol. 203: 1-5. hyorhinis and Bordetella bronchiseptica. Zentralbl Miranda-Morales R.E., Trejo V.R., López-Cerino Veterinarmed. B24: 89-96. L.E., Carrillo-Casas E.M., Sarmiento-Silva Huỳnh Thị Mỹ Lệ, Tạ Thị Kim Chung, Vũ Thị Ngọc, R.E., Trujillo-Ortega M.E., Figueroa R.B. Cao Thị Bích Phượng & Chu Thị Thanh Hương & Trigo-Tavera F.J. (2020). Frequency of (2018). Ứng dụng phản ứng Multiplex Nested PCR M. hyopneumoniae, M. hyorhinis and để phát hiện Haemophilus parasuis, Mycoplasma M. hyosynoviae in nasal and lung samples from hyorhinis và Streptococcus suis gây bệnh viêm đa pigs with symptoms of porcine enzootic thanh mạc ở lợn. Kỷ yếu Hội thảo khoa học nữ cán pneumonia. Revista Mexicana de Ciencias bộ viên chức. Nhà xuất bản Học viện Nông nghiệp. Pecuarias. 11(4): 946-960. tr. 167-175. Morita T., Ohiwa S., Shimada A., Kazama S., Kang I., Kim D., Han K., Seo H.W., Oh Y., Park C., Yagihashi T. & Umemura T. (1999). Intranasally Lee J., Gottschalk M. & Chae C. (2012). inoculated Mycoplasma hyorhinis causes Optimized protocol for multiplex nested eustachitis in pigs. Vet 82 Pathol. 36: 174-178. polymerase chain reaction to detect and differentiate Haemophilus parasuis, Streptococcus Morita T., Sasaki A., Kaji N., Shimada A., Kazama S., suis, and Mycoplasma hyorhinis in formalin-fixed, Yagihashi T., Umemura T. (1998). Induction of paraffin-embedded tissues from pigs with temporary otitis media in specific-pathogen-free polyserositis. Canadian Journal of Veterinary pigs by intratympanic inoculation of Mycoplasma Research. 76: 195-200. hyorhinis. Am J Vet Res. 59: 869-873. Lee J.A., Oh Y.R., Hwang M.A., Lee J.B., Park S.Y., Okwumabua O., O'Connor M. & Shull E. (2003). A Song C.S. & Lee S.W. (2016). Mycoplasma polymerase chain reaction (PCR) assay specific for hyorhinis is a potential pathogen of porcine Streptococcus suis based on the gene encoding the respiratory disease complex that aggravates glutamate dehydrogenase. FEMS Microbiol Lett. pneumonia caused by porcine reproductive and 218(1): 79-84. respiratory syndrome virus. Veterinary Oliveira S., Galina L. & Pijoan C. (2001). Immunology and Immunopathology. 177: 48-51. Development of a PCR test to diagnose Lin J.H., Chen S.P., Yeh K.S. & Weng C.N. (2006). Haemophilus parasuis infections. J Vet. Diagn Mycoplasma hyorhinis in Taiwan: Diagnosis and Invest. 13(6): 495-501. isolation of swine pneumonia pathogen. Vet Pallarés F.J., Halbur P.G., Schmitt C.S., Roth J.A., Microbiol. 115: 111-116. Opriessnig T., Thomas P.J., Kinyon J.M., Murphy Lobo E., Poveda C., Gupta R., Suarez A., Hernández D., Frank D.E. & Hoffman L.J. (2003). Y., Ramírez A. & Poveda J.B. (2011). Comparison of experimental models for Mycoplasmas hyorhinis in different regions of Streptococcus suis infection of conventional Cuba. Diagnosis. Braz J Microbiol. 42: 721-725. pigs. Canadian Journal of Veterinary Research. Luehrs A., Siegenthaler S., Grützner N., Grosse 67: 225-228. Beilage E., Kuhnert P. & Nathues H. (2017). Riley M.G., Russell E.G. & Callinan R.B. (1977). Occurrence of Mycoplasma hyorhinis infections in Haemophilus parasuis infection in swine. J Am fattening pigs and association with clinical signs Vet Med Assoc. 171(7):649-51. 919
nguon tai.lieu . vn