Báo cáo Y học: Molecular interaction of neutral trehalase with other enzymes of trehalose metabolism in the fission yeast Schizosaccharomyces pombe

Eur. J. Biochem. 269, 3847–3855 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03082.x Molecular interaction of neutral trehalase with other enzymes of trehalose metabolism in the fission yeast Schizosaccharomyces pombe Teresa Soto, Alejandro Franco, S. Padmanabhan, Jero Vicente-Soler, Jose Cansado and Mariano Gacto Department of Genetics and Microbiology, Facultad de Biologıa, University of Murcia, Spain Trehalosemetabolismisanessentialcomponentofthestress response in yeast cells. In this work we show that the prod-ucts of the principal genes involved in trehalose metabolism in Schizosaccharomyces pombe, tps1+ (coding for trehalose-6-P synthase, Tps1p), ntp1+ (encoding neutral trehalase, Ntp1p) and tpp1+ (that codes for trehalose-6-P phospha-tase, Tpp1p), interact in vitro with each other and with themselves to form protein complexes. Disruption of the gene tps1+ blocks the activation of the neutral trehalase inducedbyheatshockbutnotbyosmoticstress.Wepropose that this association may reflect the Tps1p-dependent requirement for thermal activation of trehalase. Data reported here indicate that following a heat shock the Synthesis and degradation of the nonreducing disaccharide trehalose is carried out by several enzymes that are widely distributed and conserved among prokaryotes and eukary-otes.Oneprobablereasonfor thisconservationis theability of trehalose to function as a general stress protectant in living organisms. Recent studies have focused on the role of trehalose in stabilizing cellular structures under conditions like desiccation, osmotic or oxidative stresses, and mild heat shock [1,2]. Studies in vitro have confirmed the exceptional properties of trehalose in protecting biological membranes or enzymes subjected to different types of extreme condi-tions [3,4]. All these findings suggest that the trehalose turnover must occur in a coordinated way for this sugar to play its diverse functional roles during the life cycle. Consequently, the study of the enzymes involved in trehalose metabolism and the subtle regulation of their activities at the molecular and cellular level have received a great deal of attention in the last decade. The best known picture for trehalose synthesis and mobilization in simple eukaryotes has emerged from studies in the budding yeast Saccharomyces cerevisiae, where trehalose synthesis is basicallyatwo-stepprocess:trehalose6-phosphatesynthesis Correspondence to J. Cansado, Department of Genetics and Microbiology, Facultad de Biologıa, University of Murcia, 30071 Murcia, Spain. Fax: + 34 68 363963, Tel.: + 34 68 364953, E-mail: jcansado@um.es Abbreviations: EMM2, Edinburgh minimal medium; GST, glutathi-one S-transferase; Ha6H, hemagglutinin antigen epitope and six histidines; Ntp1p, neutral trehalase protein; Tps1p, trehalose-6-P synthase protein; Tpp1p, trehalose-6-P phosphatase protein; TTC, triphenyltetrazolium chloride (Received 15 March 2002, revised 6 May 2002, accepted 27 June 2002) enzymeactivityoftrehalaseisassociatedwithNtp1pdimers or trimers but not with either Ntp1p monomers or with complexesinvolvingTps1p.Theseresultsraisethepossibility that heat shock and osmotic stress activate trehalase differ-entially by acting in the first case through an specific mech-anism involving Tps1p–Ntp1p complexes. This study provides the first evidence for the participation of the cata-bolic enzyme trehalase in the structural framework of a regulatory macromolecular complex containing trehalose-6-P synthase in the fission yeast. Keywords: neutral trehalase; stress; protein interaction. by trehalose-6-P synthase (TPS1) from UDP-glucose and glucose 6-P as substrates, and dephosphorylation of treha-lose-6-P to trehalose by trehalose-6-P phosphatase (TPS2). Studies based on two-hybrid analyses and on Western blot analyses of complexes obtained by gel filtration fractiona-tion concluded that TPS1 and TPS2 together with proteins TSL1 and TPS3 (which act as regulators of both synthase and phosphatase activities) form part of a multimeric protein complex of approximate molecular mass 800 kDa calledthetrehalose synthase complex [5–7]. In this complex, TPS1, TPS2, and TPS3 subunits interact with each other and among themselves (as dimers or higher order oligo-mers),whereasTSL1interactsonlywithTPS1andTPS2[6]. Another component of trehalose metabolism is the hydro-lysis of trehalose to glucose. This is catalyzed by the enzyme neutral trehalase (NTH1), whose activity is regulated by phosphorylation of the enzyme protein at serine residues [8,9]. Comparatively much less is known about the regulation of the trehalose synthesis in the evolutionarily distant yeast Schizosaccharomyces pombe. In this fission yeast, the tps1+ gene codes for trehalose-6-P synthase (Tps1p), that synthe-sizes trehalose-6-P as occurs in S. cerevisiae [10]. However, in contrast to the behaviour observed in S. cerevisiae, Dtps1 strains of S. pombe are able to grow on glucose or other readily fermentable carbon sources, although disruption of this gene does prevent spore germination [10]. Recently, we characterized a second gene of the trehalose biosynthetic pathway in S. pombe, named tpp1+, which codes for trehalose-6-P phosphatase (Tpp1p) and is responsible for the synthesis of trehalose from trehalose-6-P [11]. In S. pombe, trehalose degradation is due to the action of a 84-kDa neutral trehalase protein (Ntp1p), encoded by ntp1+ gene [12,13] activated by phosphorylation on 3848 T. Soto et al. (Eur. J. Biochem. 269) supplementing cultures with glucose and a nitrogen source. Activationofthisenzymeproteinappearstobemediatedby protein kinases Pka1p and Sck1p [14,15]. In addition, mRNA levels of ntp1+ rise when S. pombe cultures are subjected to thermal, osmotic or oxidative stresses [12,16]. The increased expression of ntp1+ is accompanied by a rise in enzyme activity, which is also regulated by the Pka1p/Sck1p pathway during osmotic and oxidative stress [16,17]. In a previous work, we showed that mutants of S. pombe disrupted in trehalose-6-P synthase function were unable to increase neutral trehalase activity under heat shock conditions or after the addition of glucose or nitrogen source. However, these Dtps1 strains still respond to osmotic stress by increasing trehalase levels [18]. Thus, in S. pombe, trehalose-6-P synthase appears to be involved in the regulation of the thermal- and nutrient-induced activa-tion of neutral trehalase but not during activation on osmotic stress. These observations raised the question of whether trehalose-6-P synthase and neutral trehalase would interact in vivo. In this paper we demonstrate that both Tps1p and Ntp1p interact in vivo and are part of distinct trehalose-6-P synthase/trehalase complexes. Moreover, trehalose-6-P phosphatase (Tpp1p) is likely a member of these complexes suggesting that regulation of trehalose synthesis and breakdown may be integrated mechanisms. Thesefindingsindicateadivergenceinthemoleculardesigns controlling trehalose metabolism in S. pombe from those in S. cerevisiae. MATERIALS AND METHODS Strains and culture media The S. pombe strains employed in this study are listed in Table 1. They were routinely grown with shaking at 28 °C in YES [19] or EMM2 with or without thiamin (5 mgÆL)1) [12]. Culture media were supplemented with adenine, leucine, histidine or uracil (100 mgÆL)1, all obtained from Sigma Chemical Co.) depending on the requirements for each particular strain. For sporulation of diploids, MEL medium was employed [19]. Solid media were made by the addition of 2% (w/v) bacto-agar (Difco Laboratories). Transformation of S. pombe strains was performed by the lithium acetate method as described elsewhere [19]. Escher-ichia coli DH5aF¢ was employed as a host to propagate plasmids. It was grown at 37 °C in Luria–Bertani medium plus 50 lgÆmL)1 ampicillin. Ó FEBS 2002 Construction of Ntp1p-, Tps1p-, and Tpp1p-tagged strains A5¢truncatedversionofntp1+ ORFwasamplifiedbyPCR employing the 5¢ oligonucleotide NTP-1 (CCGCTCGAG TCGAATATCTGCCGGAAG, which hybridizes at posi-tions 701–718 in the ntp1+ ORF and contains an internal XhoI site), and the 3¢ oligonucleotide TAG-3 (CTAC GGCGGCCGCCATTTTTATGAATGGAAA, which hybridizes at the 3¢ end of ntp1+ ORF and incorporates a NotI site placed immediately upstream of the TAA stop codon). The restriction sites in both oligonucleotides are underlined. PCRamplification employing the Expandhigh-fidelity system (Roche Molecular Biochemicals) generated a 1.6 kb fragment that was cleaved with XhoI and NotI and cloned into plasmids pIH-ura and pIH-LEU. These are integrative plasmids derived from plasmid pDS472a [20], without nmt promoter and ars1 sequences, and with ura4+ or LEU2 as selectable markers, which allow the construc-tion of vectors with Ha6H tag fusions at the C-terminus. The resulting plasmids were digested at the unique SfiI site within the ntp1+ coding region (at position 1665) and the linearfragmentstransformedintohaploidstrainsMM1and MM2, to target integration at the ntp1+ locus. Uracil or leucine prototrophs were selected for strains MM1 and MM2, respectively. The identification of strains C3 and C69, with one copy of Ntp1p–Ha6H expressed from the genomic ntp1+ promoter, was verified by Southern blot analysis and immunoblot of whole-cell extracts with anti-Ha Ig (see below). To obtain Tps1p-tagged strains, a 5¢ truncated version of tps1+ ORF was amplified by PCR employing the 5¢ oligonucleotide TPSINT-1 (CCGCTCGAGCCTAACGG TGTGGAATAC, which hybridizes at positions 715–732 in the tps1+ ORF and shows an internal XhoI site), and the 3¢ oligonucleotide TAF-3 (CTACGGCGGCCGCCCGAGC TAGAATTCATCGA, which hybridizes at the 3¢ end of tps1+ ORFandincorporatesaNotIsiteplacedimmediately upstream of the TAA stop codon). The 0.7 kb amplified PCR fragment was cleaved with XhoI and NotI and cloned into integrative plasmids pIH-ura and pIG-ura (fusion to a GST tag at C-terminus). The resulting plasmids were digested at the unique NcoI site within tps1+ (at position 1297) and the linear fragments transformed into haploid strain MM1, to target integration at the tps1+ locus. Uracil prototrophs were selected and the identification of strains C4 and C5, with one copy of Tps1p–GST or Tps1p–Ha6H Table 1. S. pombe strains used in this study. Strain MM1 MM2 C3 C69 C4 C5 C694 MMPI-3a MMPI-3b C33 Genotype h+ ade6-M216 leu 1-32 ura4-D18 h– ade6-M210 leu 1-32 ura4-D18 h+ ade6-M216 leu 1-32 ura4-D18 ntp1+:Ha6H (ura4+) h– ade6-M210 leu 1-32 ura4-D18 ntp1+:Ha6H (LEU2) h) ade6-M216 leu 1-32 ura4-D18 tps1+:GST (ura4+) h) ade6-M216 leu 1-32 ura4-D18 tps1+:Ha6H (ura4+) h+ ade6-M216 leu 1-32 ura4-D18 ntp1+:Ha6H (LEU2) tps1+:GST (ura4+) h+ ade6-M216 leu 1-32 ura4-D18 tpp1+:Ha6H (ura4+) h– ade6-M210 leu 1-32 ura4-D18 tpp1+:Ha6H (ura4+) h– ade6-M210 leu 1-32 ura4-D18 tpp1+:Ha6H (ura4+) ntp1+:Ha6H (ura4+) tps1+:Ha6H (ura4+) Source/Reference M. Yamamoto A. Duran This study This study This study This study This study [11] [11] This study Ó FEBS 2002 Neutral trehalase complexes in fission yeast (Eur. J. Biochem. 269) 3849 expressed from the genomic tps1+ promoter, was verified by Southern blot analysis and immunoblot of whole-cell extracts with anti-GST or anti-Ha Ig, respectively. The double-tagged strain C694 (Ntp1p–Ha6H, Tps1p– GST) was constructed by mating strains C69 and C4, and selecting diploids in EMM2 medium without supplements. Sporulationwas performedinMELmediumandthespores purified by glusulase treatment [21] were allowed to germinate in minimal medium plus adenine. Strains with thedouble-taggedgenotypewereidentifiedbySouthernand immunoblot analysis with anti-HA and anti-GST Ig. Double-tagged strain C33 (Ntp1p–Ha6H, Tpp1p–Ha6H) was constructed by mating strains C3 and MMPI-3b, and selecting diploids in EMM2 medium with leucine. After spore purification and germination, the double-tagged strains were identified by Southern and immunoblot analysis with anti-Ha Ig. The triple-tagged strain C335 (Ntp1p–Ha6H,Tps1p–Ha6H,Tpp1p–Ha6H)wasobtained after mating strains C33 and C5, and Southern and immunoblot analysis of germinated spores, as described above. Expression of Tps1p–GST and Ntp1p–GST fusions Thetps1+ ORFwasamplifiedbyPCRwitholigonucleotides TPS-5 (CCGCTCGAGGAATCTTTGTTTTGCTGA, which hybridizes at sequences upstream of the ATG start codon in the tps1+ ORF and shows an internal XhoI site), and TAF-3. The 1.5 kb product was cloned into the XhoI/ NotI sites of plasmid pDS472M, which is a derivative of plasmid pDS472a with an attenuated version of the nmt1 promoter and LEU2 selectable marker, to create plasmid pTGST, which expresses trehalose-6-P synthase (Tps1) fused to GST at the C-terminus under the control of the medium strength thiamin-repressible promoter. pTGST and control plasmid pDS472M (unfused GST) were transformed into strains C3, C5 and MMPI-3, and leucine prototrophs selected in EMM2 medium plus adenine. For Ntp1p–GST expression, ntp1+ ORF was amplified by PCR with oligonucleotides NTP-5 (CCGCTCGAGG CTATCATTCGTGAATAG,whichhybridizesatsequences upstream of the ATG start codon in the ntp1+ ORF and showsaninternalXhoIsite),andTAG-3.The1.5 kbproduct was cloned as above into pDS472M to create plasmid pNGST,containinganin-framefusionwherethe3¢endofthe ntp1+ ORF is followed by the GST epitope, and whose expressionisunderthecontrolofthemediumstrengthnmt1 thiamin-repressible promoter. Both pNGST and control plasmidpDS472MweretransformedintostrainsC3,C5and MMPI-3,andleucineprototrophswereselected. Purification of Ha6H- and GST-tagged proteins by affinity chromatography Total cell homogenates were prepared under native condi-tions employing chilled acid-washed glass beads and lysis buffer (10% glycerol, 50 mM Tris/HCl pH 7.5, 150 mM NaCl, 0.1% Nonidet NP-40, plus an specific protease inhibitor cocktail for fungal and yeast extracts obtained from Sigma Chemical Co.). The lysate was removed and cleared by centrifugation at 10 000 g for 30 min. Ha6H-tagged proteins were purified by using Ni2+-nitrilotriacetic acid-agarose beads (Qiagen Inc.) whereas GST and GST- taggedproteinswereprecipitatedusingglutathioneglutathi-one–Sepharosebeads(Amersham-Pharmacia)followingthe proceduresdescribedbyShiozaki&Russell[22]. Immunoprecipitation of Ha6H- and GST-tagged proteins For immunoprecipitation of Ha6H-tagged proteins, the extracts were incubated for 12 h at 4 °C with monoclonal mouse anti-Ha Ig (clone 12CA5, Roche Molecular Bio-chemicals), and the immunocomplexes were adsorbed with protein A–agarose (Roche Molecular Biochemicals) for 4 h at 4 °C. The immunoprecipitation of GST-tagged proteins was performed with a polyclonal sheep anti-GST Ig (Amersham-Pharmacia) and protein G–agarose (Roche Molecular Biochemicals). In all cases the suppliers’ recom-mendations were followed in terms of incubation times and washing of the complexes. Detection of neutral trehalase activity in gel Affinity purified Ntp1p-Ha and Tps1p–GST proteins were mixed with loading buffer (100 mM Mes pH 6, 15% glycerol and 0.01% bromophenol blue), and resolved at 4 °C in native 6% polyacrylamide gels (200 V for 8 h), employing Tris/borate pH 7.5 as running buffer. The gels werethenwashedwith100 mM MespH 6.0for10 min,and incubated with 100 mM Mes pH 6 plus 200 mM trehalose (Sigma Chemical Co.) for 2 h at 30 °C. After washing with distilled water, active neutral trehalase proteins were detected in situ by incubating the gels with 0.1% TTC in 0.5 M sodium hydroxide at 80 °C. Color development was stopped with a 7.5% acetic acid solution. Gel filtration A Superdex-200 column (Amersham-Pharmacia) equili-brated with buffer A (10 mM Mes, pH 6.0, 150 mM NaCl) was used for size-exclusion analysis in an AKTA HPLC system (Amersham-Pharmacia). Lower salt concentrations were not used in order to minimize nonspecific electrostatic interactions with the column matrix. The column was calibrated using vitamin B12 (1.3 kDa), cytochrome c (12.4 kDa), carbonic anhydrase (29 kDa), ovalbumin (43 kDa), BSA (66 kDa), yeast alcohol dehydrogenase (150 kDa), b-amylase (200 kDa), apoferritin (430 kDa) and thyroglobulin (670 kDa) (all from Sigma Chemical Co.) at the concentrations recommended by the manufac-turer. One-hundred microliters (1 mg total protein) of the supernatant from ultracentrifuged extract obtained from triple-tagged strain C335 grown to mid-log phase, after eitheraheatshock(40 °C,1 h)oranosmoticshock(0.75 M NaCl, 2 h) were applied to the column with buffer A plus a yeast protease inhibitor cocktail (Sigma Chemical Co.). A flow rate of 0.4 mLÆmin)1 was used and the elution was tracked by absorbance at 280, 235 and 220 nm. Blue Dextran (2000 kDa; Sigma) and vitamin B12 were used for void volume (Vo) and total bed volume (Vt) determinations, respectively. Molecular masses were estimated from a calibration curve (correlation coefficients ‡0.98) generated by linear regressions of the elution volume for each protein using SIGMAPLOT (Jandel Scientific). To determine the fractions containing Ntp1p-, Tps1p-, and Tpp1p–Ha6H tagged proteins, 100 lL of each fraction (0.4 mL) were 3850 T. Soto et al. (Eur. J. Biochem. 269) Ó FEBS 2002 trichloroacetic-acid-precipitated, washed with cold acetone, air-dried, resuspended in SDS gel sample buffer, and resolved in SDS/PAGE (10%) gels. Immunoreactive bands were detected by Western blot analysis with anti-Ha Ig (see below). SDS/PAGE and Western blotting Proteins were resolved in 8 or 10% SDS/PAGE gels as previously described [11], transferred to nitrocellulose filters (Amersham-Pharmacia), and incubated with mouse anti-Ha or sheep anti-GST Ig. The immunoreactive bands were revealed with HRP-conjugated secondary Ig [anti-(mouse IgG)Igoranti-(sheepIgG)Ig;SigmaChemicalCo.]andthe ECL system (Amersham-Pharmacia). Enzyme assays and trehalase activation Trehalase activity was assayed after cell breakage as described previously [23]. Activation of trehalase by heat treatment or osmotic shock was carried out as indicated earlier [17]. Enzyme activity in eluates was expressed as nmol glucose produced per min. All trehalase determina-tions were repeated at least three times with consistent results. Representative results are shown. Specific activity of trehalase in slab gels was expressed as enzyme units per mg protein. Protein determination was performed by absor-bance measurement at 280 and 205 nm according to the method described in previously [24]. RESULTS Neutral trehalase and trehalose-6-P synthase association in vitro In order to analyse possible interactions between treha-lose-6-P synthase and neutral trehalase interaction in vitro, we constructed strains C3 and C69, which express a C-terminal Ha6H-tagged version of neutral trehalase (Ntp1p, 84 kDa) under the control of the genomic promoter. These strains showed the same growth behavior and neutral trehalase activation pattern as the parental strains MM1 and MM2 for a variety of conditions. Strain C3 was further transformed with plasmid pTGST, which expresses trehalose-6-P synthase (55 kDa) fused to a GST epitope (25 kDa) at its C-terminus under the regulation of an attenuated version of the thiamin-repressible promoter [20]. Several transfor-mants were cultured in minimal medium plus thiamin, and then transferred to the same medium without thiamin to allow synthesis of the Tps1p–GST fusion protein. The cells were collected at mid-log phase of growth, and Tps1p–GST was affinity-purified employing glutathione (glutathione)–Sepharose beads. As shown in Fig. 1 (lane 2), significant levels of Tps1p–GST were detected employing anti-GST Ig under these conditions. However, if Tps1p interacts with Ntp1p in vitro, Ntp1p–Ha6H should be detectable with anti-Ha Ig after Tps1p–GST purification. As shown in Fig. 1 (lane 6), this appears to be the case, and a clear band of the size expected for Ntp1p–Ha6H fusion was visible after hybridization with anti-Ha Ig. Besides, the Ntp1p–Ha6H signal was absent when strain C3 was transformed with a control plasmid that expresses Fig. 1. Ntp1p–Tps1p association takes place in vivo in growing cells of S. pombe, and in cells subjected to heat and osmotic stresses. Strain C3, with a Ha6H epitope-tagged version of Ntp1p, was transformed with plasmids pDS472a (unfused GST; lanes 1 and 5) or pTGST (Tps1p– GST fusion; lanes 2, 3, 4, 6, 7 and 8). GST and Tps1p–GST fusions wereexpressedusingthemedium-strengththiamin-regulatedpromoter for 24 h. Yeast lysates prepared from exponentially growing cells (lanes 2 and 6), or from either heat- (lanes 3 and 7) or osmotically shocked cells (lanes 4 and 8), were adsorbed with glutathione–Sepha-rose beads. After extensive washing in lysis buffer, the proteins bound to the beads were analyzed by Western blot using anti-GST (lanes 1–4) and anti-Ha Ig (lanes 5–8). unfused GST (Fig. 1, lane 5). Taken together, these results indicate that Ntp1p and Tps1p interact in vitro in S. pombe, and that the nature of this association is specific and independent of the presence of the GST domain fused to Tps1p. Ntp1p–Tps1p association takes place during normal yeast growth and thermal shock, but might not occur when the cells are stressed by an osmotic upshift [18]. To test this possibility, we performed the same experiment described above by subjecting strain C3 plus plasmid pTGST either to osmotic stress or to a thermal one. As shown in Fig. 1, Ntp1p–Tps1p association was observed not only in control, exponentially growing cells but also for both thermal as well as osmotic stresses (lanes 7 and 8). Thus, in S. pombe, Ntp1p–Tps1p interaction does not appear to be transient but is stable, and is maintained even under conditions where the presence of Tps1p is not needed for neutral trehalase activation (osmotic shock). These results, however, do not exclude by themselves the possibi-lity that some Ntp1p might be in a free, nonassociated state (see below). We employed a medium-strength thiamin-repressible promoter for Tps1p–GST expression in Ntp1p–Ha6H cells to achieve low levels of Tps1p–GST synthesis. Although Ntp1p–Ha6H was not detectable in the absence of the Tps1p–GST fusion, it was conceivable that the described Tps1p–Ntp1p interaction could be due, in part, to the presenceofnonphysiologicallevels ofTps1p–GST.In order to clarify this point, we constructed the S. pombe double-tagged strain C694. This strain expresses Ntp1p and Tps1p fused at their C-terminus to Ha6H and GST epitopes, respectively, and in both cases the synthesis is regulated by their own genomic promoters. The Tps1p fusion protein is active because strain C694 synthesizes trehalose at normal level. This strain was grown in rich medium to mid-log phase, and after obtaining the corresponding extracts, Tps1p–GST and Ntp1p–Ha6H were immunoprecipitated with anti-GST and anti-Ha Ig, respectively. As shown in Fig. 2 (lane 2), the Ntp1p–Ha6H band was clearly detected Ó FEBS 2002 Neutral trehalase complexes in fission yeast (Eur. J. Biochem. 269) 3851 Fig. 2. Ntp1p and Tps1p coimmunoprecipitate and associate to form complexes devoid of neutral trehalase activity. (A) The double-tagged strainC694(Ntp1p–Ha6H,Tps1p–GST)wasgrownto mid-logphase, and Tps1p–GST and Ntp1p–Ha6H were immunoprecipitated from the corresponding extracts with anti-Ha Ig (lanes 1 and 5) or anti-GST Ig (lanes 2 and 4) Ig. After incubation with protein A–agarose (anti-Ha immunoprecipitations) or protein G–agarose (anti-GST immunoprecipitations) and extensive washing, the immunocomplexes wereresolvedbySDS/PAGEandanalyzedbyWesternblotusinganti-Ha (lanes 1, 2 and 3) or anti-GST Ig (lanes 3, 5 and 6). Lanes 3 and 6 correspond to negative controls without immunoprecipitation but incubated with protein A–agarose (lane 3) or protein G–agarose (lane 6)toaccountforpossiblenonspecificproteinbindingtothematrix.(B) Upper panel: Affinity-purified Ntp1p–Ha6H and Tps1p–GST were preparedfrom exponentially growing cells ofstrain C694 prior (lanes1 and 4) and after osmotic (lanes 2 and 5) or heat stress (lanes 3 and 6). Samples were resolved by native PAGE and spots developed for neutral trehalase activity. Lower panel: quantitative estimation of enzyme activity (as trehalase units per mg protein) in each sample. with anti-Ha Ig in the complexes obtained from Tps1p– GST immunoprecipitation, whereas Tps1p–GST was visi-ble with anti-GST Ig after Ntp1p–Ha6H immunoprecipi-tation (lane 5). In this strain, the existence of Ntp1p–Tps1p interaction was evident not only in growing cells, but also during heat or osmotic stress (not shown). These data strongly suggest the existence of an in vivo association between Ntp1p and Tps1p in S. pombe over a variety of environmental conditions. To ascertain the functional significance of this interac-tion, we developed a gel assay for neutral trehalase activity (see Materials and methods) and determined the enzyme activity of Ntp1p bounded to Tps1p in exponen-tially growing cells from double-tagged strain C694 and in cultures subjected to heat or osmotic stress. As shown in Fig. 2B, affinity-purified Ntp1p–Ha6H from growing cells displayed a typical pattern of neutral trehalase activity, with low level of enzyme activity in unstressed cells that increases strongly upon stress. Notably, we were unable to detect in situ any neutral trehalase activity associated to native Tps1–GST protein purified with glutathione– Sepharose beads in samples from either unstressed, osmotic- or heat-shocked cells. A quantitative estimation of neutral trehalase activity gave similar results (Fig. 2B, lower panel). Because a significant fraction of Ntp1p protein is bounded in vitro to Tps1p (see Figs 1 and 2A), these results demonstrate that in S. pombe the active form of neutral trehalase exists in a free, non Tps1p-associated state, independently of the environmental condition used for stress. We focussed then our attention on the likelihood that Tps1p or Ntp1p undergo self-association. This has been previously reported for the Tps1p homologue in S. cerevisiae [6]. Using the same experimental procedure used in Fig. 1, we observed that self-association does indeed take place for both proteins. As can be seen in Fig. 3A (lane 4) and Fig. 3B (lane 4), both Ntp1p– Ha6H and Tps1p–Ha6H were detected employing anti-Ha Ig after Ntp1p–GST and Tps1p–GST purification, respectively. These and other results (see below) support Fig. 3. Ntp1p and Tps1p self-interact in vivo. (A) Ntp1p–Ntp1p interaction. The Ntp1p–Ha6H epitope-tagged strain C3 was transformed with plasmids pDS472a (unfused GST; lanes 1 and 3) or pNGST (Ntp1p–GST fusion; lanes 2 and 4). GST and Ntp1p–GST fusions were expressed using the medium-strength thiamin-regulated promoter for 24 h. Yeast lysates were adsorbed with glutathione–Sepharose beads and after washing in lysisbuffer the proteinsbound to the beadswere analyzed by SDS/PAGE and Western blotting using anti-GST Ig (lanes 1 and 2)and anti-Ha Ig (lanes 3 and 4). (B) Tps1p–Tps1p interaction. The Tps1p–Ha6H epitope-tagged strain C5 was transformed with plasmids pDS472a (unfused GST; lanes 1 and 3) or pTGST (Tps1p–GST fusion; lanes 2 and 4). GST and Tps1p–GST fusions were expressed using the medium-strength thiamin-regulated promoter for 24 h. Yeast lysates were processed as described above, and the proteins bound to glutathione beads were analyzed after SDS/PAGE using anti-GST Ig (lanes 1 and 2) and anti-Ha Ig (lanes 3 and 4). ... - tailieumienphi.vn