Báo cáo Y học: GNA33 from Neisseria meningitidis serogroup B encodes a membrane-bound lytic transglycosylase (MltA)

Eur. J. Biochem. 269, 3722–3731 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03064.x GNA33 from Neisseria meningitidis serogroup B encodes a membrane-bound lytic transglycosylase (MltA) Gary T. Jennings1*, Silvana Savino1*, Elisa Marchetti1, Beatrice Arico1, Thomas Kast2, Lucia Baldi1, Astrid Ursinus2, Joachim-Volker Ho¨ltje2, Robert A. Nicholas3, Rino Rappuoli1 and Guido Grandi1 1I.R.I.S., Chiron S.p.A., Siena, Italy; 2Max Planck Institute fur Entwicklungsbiologie, Abteilung Biochemie, Tubingen, Germany; 3Department of Pharmacology, University of North Carolina at Chapel Hill, NC, USA In a previous study, we used the genome of serogroup B Meningococcus to identify novel vaccine candidates. One of these molecules, GNA33, is well conserved among Men-ingococcus B strains, other Meningococcus serogroups and Gonococcusandinducesbactericidalantibodiesasaresultof being a mimetic antigen of the PorA epitope P1.2. GNA33 encodes a 48-kDa lipoprotein that is 34.5% identical with membrane-bound lytic transglycosylase A (MltA) from Escherichia coli. In this study, we expressed GNA33, i.e. Meningococcus MltA, as a lipoprotein in E. coli. The lipo-protein nature of recombinant MltA was demonstrated by incorporation of [3H]palmitate. MltA lipoprotein was purified to homogeneity from E. coli membranes by cation-exchange chromatography. Muramidase activity was con- Neisseria meningitidis is a Gram-negative, capsulated b-proteobacterium capable of causing severe meningitis and septicemia with a fatality rate of 10% [2]. The complete2 272 351-bpgenomicsequenceofMeningococcus serogroup B (strain MC58) has been determined and used by us to identify novel vaccine candidates against this pathogenic organism [1,2]. We amplified, cloned and expressed in Escherichia coli selected ORFs encoding pro-teins with predicted surface exposure. Recombinant pro-teins were purified, immunized in mice, and the resultant sera analysed by FACS, ELISA, and bactericidal assay. GNA33 was positive in all three analyses and highly conserved (99.2± 0.7%) among 22 strains of Meningococ-cus B, nine strains from Meningococcus serogroups A, C, Y, X, Z, W135, and 95.8% conserved in Neisseria gonorrhoeae [1]. Further study revealed that GNA33 elicits protective antibodiestomeningococcibymimickingasurface-exposed epitope on loop 4 of porin A in strains with serosubtype P1.2 [3]. Correspondence to G. T. Jennings, Cytos Biotechnology AG, Wagistrasse 25, CH-8952 Zurich-Schlieren, Switzerland. Fax: + 41 1 733 4659, Tel.: + 41 1 733 4642, E-mail: jennings@cytos.com Abbreviations: GNA, genome-derived Neisseria antigen; LPSS, lipo-polypeptide signal sequence; MipA, MltA-interacting protein; MltA, membrane-bound lytic transglycosylase A; PBP, penicillin-binding protein. *Note: these authors contributed equally to this work. (Received 29 March 2002, revised 14 June 2002, accepted 20 June 2002) firmed when MltA was shown to degrade insoluble murein sacculi and unsubstituted glycan strands. HPLC analysis demonstrated the formation of 1,6-anhydrodisaccharide tripeptide and tetrapeptide reaction products, confirming that the protein is a lytic transglycosylase. Optimal muramidase activity was observed at pH 5.5 and 37 °C and enhancedbyMg2+,Mn2+ andCa2+.TheadditionofNi2+ and EDTA had no significant effect on activity, whereas Zn2+ inhibited activity. Triton X-100 stimulated activity 5.1-fold. Affinity chromatography indicated that MltA interacts with penicillin-binding protein 2 from Meningo-coccus B, and, like MltA from E. coli, may form part of a multienzyme complex. The ORF of GNA33 encodes a protein 441 amino acids in length with an N-terminal 20-amino-acid lipopolypep-tide signal sequence (LPSS) with a consensus lipoprotein-processing site, LAAC [4]. Sequence comparison showed that GNA33 is 34.5% identical and 41.3% homologous with the 38-kDa membrane-bound lytic transglycosylase A (MltA) from E. coli (Fig. 1). In E. coli, four additional exo-specific lytic transglycoylases (MltB, MltC, MltD, and Slt70) have been identified and/or characterized [5–8]. These lytic transglycosylases exhibit no significant sequence homology with each other. With the exception of Slt70 (soluble lytic transglycosylase), they are all lipoproteins that attach to the outer membrane [7–10]. Homologues of all these lytic transglycosylases have been identified in Meningococcus B [2], which, like their E. coli counterparts, also exhibit little sequence conservation with each other. Lytictransglycosylasesareauniqueclassoflysozyme-like enzymes that catalyze cleavage of the b-1,4-glycosidic bond between N-acetylmuramic acid (MurNAc) and N-acetyl glucosamine (GlcNAc). However, unlike lysozyme where the glycosyl moiety is transferred to H2O, cleavage by lytic transglycosylases is followed by an intramolecular transgly-cosylation [10]. In this reaction, the glycosidic linkage between the muramyl and glucosaminyl residues is trans-ferred to the C6 position of the muramyl residue to form terminal 1,6-anhydromuramic acid-containing products [10]. By virtue of their ability to cleave the polysaccharide backbone of the peptidoglycan layer, lytic transglycosylases are thought to play a role in synthesis and degradation of the murein sacculus. It has been proposed that lytic transglycosylasesplayimportantrolesincellularelongation, Ó FEBS 2002 MltA from N. meningitidis serogroup B (Eur. J. Biochem. 269) 3723 Fig. 1. Amino acid sequence of MltA from N. meningitidis serogroup B: comparison with MltA from E. coli. The amino-acid sequence of MltA from Meningococcus B (strain 2996) (NmMltA) was compared with MltA from E. coli (EcMltA) using the GAP program included in the Genetics Computer Group (GCG) Wisconsin Package version 10.0. The 20-amino-acid LPSS is underlined. The LPSS was identified using the program PSORT avail-able at http://psort.nibb.ac.jb. The 19-amino-acid LPSS from the Meningococcus B gene GNA1946 (GNA1946L), was used to replace the MltA leader peptide and is shown above the meningococcal sequence. Amino acids are identified by the standard single letter code. septation, recycling of muropeptides, and pore formation [7,10,11]. Current models of cell wall synthesis in Gram-negative bacteria predict the necessity for murein synthases and lytic enzymes to interact in a co-ordinated and controlled manner [10]. Indeed, interactions between lytic transgly-cosylases (MltA, MltB and Slt70), bifunctional transgly-cosylase-transpeptidases (PBP1A, PBP1B, PBP1C), transpeptidases (PBP2, PBP3), and endopeptidases (PBP4 and PBP7) of E. coli have been reported [12,13]. In particular, affinity chromatography and/or surface plasmon resonance have shown interactions between MltA, PBP1B, PBP1C, PBP2, PBP3 and a newly identi-fied scaffolding protein, MipA [14]. It is thought that, through such interactions, the enzymes required for cell wall metabolism associate and form a multienzyme complex [10,14]. An enzyme complex would not only provide a means for regulating peptidoglycan synthesis but would also provide a way to control the potentially autolytic activity of proteins such as MltA. To date, no evidence of these associations in Neisseria species has been reported. In this study we cloned GNA33 (MltA) from Meningo-coccus serogroup B. The recombinant lipoprotein was expressed in E. coli, purified, and assayed for its muram-idaseandlytictransglycosylaseactivity.Inaddition,weused affinity chromatography to investigate the hypothesis that MltA associates with other enzymes involved in peptido-glycan metabolism and thus may be part of a multienzyme complex. EXPERIMENTAL PROCEDURES Vector construction Three versions of meningococcal mltA were amplified by PCR and cloned into the expression vector pET21b+ (Novagen) via 5¢ NdeI and 3¢ XhoI restriction sites. These included a full-length form incorporating its endogenous 20-amino-acid LPSS, a form containing a 19-amino-acid LPSS from an unrelated Meningococcus B lipoprotein, GNA1946 [1], and a truncated form lacking any leader sequence (Fig. 1). Full-length mltA was amplified using a forward primer containing an NdeI restriction site (5¢-CGCGGATCCCA TATGAAAAAATACCTATTCCGC-3¢) incorporating the ATG start codon. The reverse primer (5¢-CCCGCTC GAGTTACGGGCGGTATTCGG-3¢) contained a XhoI restriction site and was used for all three constructs. The construct containing the GNA1946 LPSS was made using a forward primer (5¢-GGGAATTCCATATGAAAACCTT CTTCAAAACCCTTTCCGCCGCCGCGCTAGCGCT CATCCTCGCCGCCTGCCAAAGCAAGAGCATC-3¢) spanning the entire leader of GNA1946 and containing 18 nucleotides overlapping the mltA sequence. A conservative double nucleotide substitution (underlined) was made in a region of the primer encoding the GNA1946 LPSS. This substitution introduced an NheI restriction and was designed to allow the GNA1946 LPSS to be ligated into any of the meningococcus genes that we have previously expressed in pET-21b[1]. This restriction site was not used 3724 G. T. Jennings et al. (Eur. J. Biochem. 269) in this study. The truncated gene lacking the 20-amino-acid leader peptide was amplifed using the forward primer, 5¢-CGCGGATCCCATATGCAAAGCAAGAGCATCC AAA-3¢. PCR was performed in a reaction volume of 100 lL comprising 10 mM Tris/HCl (pH 8.3), 50 mM NaCl, 1.5 mM MgCl2,0.8 mM dNTPs,40 lM eacholigonucleotide primer, and 2.5 U TaqI DNA polymerase (PerkinElmer, Boston, MA, USA). Template DNA for the reaction was 200 ng genomic DNA from Neisseria meningitidis B 2996. The primary denaturation step was performed at 94 °C for 3 min and the remainder of the first five cycles with denaturation, annealing and polymerization conditions of 94 °C for 40 s, 52 °C for 40 s and 72 °C for 1 min, respectively. The annealing temperature was increased to 65 °C for the next 30 cycles, and a final 7 min extension at 72 °C completed the reaction. PCR products were purified using the Qiagen Gel Extraction Kit. Ligations and transformations into E. coli DH5 were performed as described by Sambrook et al. [15]. After selection, amplifi-cationandpurification,theplasmidswereusedtotransform E. coli BL21(DE3) (Novagen, Madison, WI, USA). The genomic sequence of Meningococcus B is known for the strain MC58 [2]. The nucleotide sequence of mltA from strain 2996 has 17 nucleotide substitutions (of which 16 are silent) with respect to mltA from strain MC58. Only one of these base changes results in an amino-acid substitution, Ser312 to Ala. Expression and purification of recombinant MltA E. coli BL21(DE3) cells harboring the three versions of pET21b-MltA (see above) were grown at 30 °C in Luria– Bertani medium containing 100 lgÆmL)1 ampicillin until the D550 reached 0.6–0.8. Isopropyl thio-b-D-galactoside was added to a final concentration of 1.0 mM, and the culture shaken for an additional 3 h. Cells were collected by centrifugation at 8000 g for 15 min at 4 °C. All subsequent procedures were performed at 4 °C. For purification of lipidated MltA, cells were resuspend-ed in 25 mL 50 mM phosphate/300 mM NaCl, pH 8.0, containing complete protease inhibitor (Roche, Basel, Switzerland). Bacteria were disrupted by osmotic shock with two or three passages through a French Press (SLM Aminco). Unbroken cells were removed by centrifugation at 5000 g for 15 min, and membranes sedimented by centrifugation at 100 000 g for 45 min. The pellet was resuspended in 20 mM Tris/HCl (pH 8.0)/1.0 M NaCl containing complete protease inhibitor, and the suspension mixed for 2 h. After centrifugation at 100 000 g for 45 min, the pellet was resuspended in 20 mM Tris/HCl (pH 8.0) containing 1.0 M NaCl, 5.0 mgÆmL)1 Chaps, 10% (v/v) glycerol and complete protease inhibitor. The solution was stirred overnight, centrifuged at 100 000 g for 45 min, and the supernatant dialysed for 6 h against 20 mM Bicine (pH 8.5)/120 mM NaCl/5.0 mgÆmL)1 Chaps/10% (v/v) glycerol. The dialysate was cleared by centrifugation at 13 000 g for 20 min and applied to a Mono S FPLC ion-exchange column (Pharmacia, Uppsala, Sweden) at a flow rate of 0.5 mLÆmin)1. Elution was performed using a stepwise NaCl gradient. The protein was also expressed and purified in a form lacking the LPSS. After expression and harvesting, cells Ó FEBS 2002 were resuspended in 20 mM Bicine (pH 8.5)/20 mM NaCl/ 10% (v/v) glycerol containing complete protease inhibitor anddisruptedwithaBransonSonifier450.Thesonicatewas centrifuged at 8000 g for 30 min to remove unbroken cells, and MltA was precipitated from the supernatant by the addition of saturated (NH4)2SO4 solution. MltA was precipitated between 35% and 70% saturation and was collected by centrifugation at 8000 g for 30 min. The pellet was dissolved in 20 mM Bicine (pH 8.5)/20 mM NaCl/10% (v/v)glycerolanddialysedagainstthisbufferovernight.The dialysate was centrifuged at 13 000 g for 20 min, and the supernatantwasapplied toanFPLCMono Sion-exchange column at a flow rate of 0.5 mLÆmin)1. The protein was eluted from the column with a stepwise NaCl gradient. PurificationswereanalysedbySDS/PAGE[16],andprotein concentration determined by the Bradford method. West-ern-blotanalysiswasperformedusingpolyclonalantiseraas described previously [1]. Palmitate labelling Palmitate incorporation by recombinant MltA was con-firmed as described by Kraft et al. [17]. Briefly, E. coli BL21(DE3) harbouring one of the three pET21b-MltA constructs were grown at 30 °C in Luria–Bertani medium containing 100 lgÆmL)1 ampicillin and 5 lCiÆmL)1 [3H]palmitate (Amersham) until the D550nm reached 0.4–0.8. Expression of recombinant protein was induced for 1 h by the addition of isopropyl b-D-thiogalactoside (final concentration 1 mM), and the bacteria harvested by centrifugationat3000 gfor15 min.Cellswerewashedtwice with cold NaCl/Pi, suspended in 20 mM Tris/HCl (pH 8.0)/ 1 mM EDTA/1.0% (w/v) SDS, lysed by boiling for 10 min, and centrifuged for 10 min at 13 000 g. Cold acetone was added to the supernatant, and, after 1 h at )20 °C, protein was collected at 13 000 g for 10 min. Protein was resus-pended in 1.0% (w/v) SDS, boiled with SDS/PAGE sample buffer, and subjected to SDS/PAGE using a 12.5% separating gel. Gels were fixed for 1 h in 10% (v/v) acetic acid, and soaked for 30 min in Amplify solution (Amer-sham). The gel was vacuum-dried under heat and exposed to Hyperfilm (Kodak) overnight at )80 °C. Assay for muramidase activity Purified, recombinant MltAs expressed with the GNA1946 LPSS or without an LPSS were assessed for their ability to degrade insoluble murein sacculi into soluble muropeptides by the method of Ursinus & Holtje [18]. Murein lysis activity was determined using peptidoglycan radiolabelled with meso-2,6-diamino-3,4,5-[3H]pimelic acid as substrate. Enzyme (3–10 lg total) was incubated for 45 min at 37 °C in a total volume of100 lLcomprising 10 mM Tris/maleate (pH 5.5), 10 mM MgCl , 0.2% (v/v) Triton X-100 and [3H]diaminopimelic acid-labelled murein sacculi ( 10 000 c.p.m.). The assay mixture was placed on ice for 15 min with 100 lL 1.0% (w/v) N-cetyl-N,N,N-trime-thylammonium bromide, and the precipitated material separated by centrifugation at 10 000 g. The radioactivity in the supernatant was measured by liquid-scintillation counting.TheE. colilytictransglycosylaseSlt70wasusedas a positive control for the assay, and the negative control comprised the above assay solution without enzyme. Ó FEBS 2002 MltA from N. meningitidis serogroup B (Eur. J. Biochem. 269) 3725 Assay for lysis of poly(MurNAc-GlcNAc) glycan strands The ability of MltA to utilize purified glycan strands as substrate was determined by the method described by Ursinus & Holtje [18]. Poly(MurNAc-GlcNAc)n>30, labelled with N-acetyl-D-1-[ H]glucosamine, was incubated with 3 lg MltA in 10 mM Tris/maleate (pH 5.5)/10 mM MgCl2/0.2% (v/v) Triton X-100 for 30 min at 37 °C. The reaction was stopped by boiling for 5 min, and the pH of the sample adjusted to 3.5 by addition of 10 lL 20% (v/v) phosphoric acid. The components of the assay were then separated by RP-HPLC on a Nucleosil 300 C18 column as described by Harz et al. [19]. The E. coli lytic transglycos-ylase MltA was used as a positive control in the assay. A negative control was performed in the absence of enzyme. Analysis of reaction products The nature of the reaction products resulting from the digestion of unlabelled E. coli murein sacculus were deter-mined by RP-HPLC as described by Glauner [20]. Murein sacculi digested with the muramidase Cellosyl were used to calibrate and standardize the Hypersil ODS column. Gel filtration The molecular masses of the recombinant proteins were estimated using either FPLC Superose 12 (H/R 10/30) or Superdex 75 gel-filtration columns (Pharmacia). The buf-fers were 20 mM Bicine (pH 8.5) with and without 5.0 mgÆmL)1 Chaps, respectively. In addition, each buffer contained 150–200 mM NaCl and 10% (v/v) glycerol. Proteins were dialysed against the appropriate buffer and applied ina volume of 200 lL. Gel filtration was performed with a flow rate of 0.5–2.0 mLÆmin)1 and the eluate monitored at 280 nm. Fractions were collected and analysed by SDS/PAGE. Blue Dextran 2000 and the molecular-mass standards ribonuclease A, chymotryp-sin A, ovalbumin A, and BSA (Pharmacia) were used to calibrate the columns. The molecular mass of the sample was estimated from a calibration curve of Kav vs. log (molecular mass) of the standards. Preparation of membrane extracts for affinity chromatography A detergent-solubilized membrane extract was prepared from an acapsulated N. meningitidis strain, M7. An over-night culture of strain M7 was inoculated into 2 L Muller-Hintonbrothcontaining0.25%(w/v)glucose,andgrownat 37 °C in an atmosphere of 5.0% CO2. When the D550 reached 0.6, the culture was cooled on ice and harvested by centrifugation at 8000 g; all the following steps were performed at 4 °C. The pellet was resuspended in 10 mM Tris/HCl (pH 8.0) containing complete protease inhibitor and DNase (10 lgÆmL)1), and the cells were disrupted with a French Press. Membranes were spun down at 100 000 g for 45 min and resuspended in 10 mM Tris/maleate (pH 6.8) containing 2.0% (v/v) Triton X-100, 10 mM MgCl2, 150 mM NaCl and EDTA-free complete protease (buffer I). After stirring overnight, membrane debris was removed by centrifugation (100 000 g for 45 min), and the supernatantcontainingsolubilizedproteinstoredat)20 °C. Affinity chromatography Purified leaderless MltA (10 mgÆmL)1 gel) was coupled to CNBr-activated Sepharose 4B (Pharmacia) according to the manufacturer’s protocol. CNBr-activated Sepharose 4B prepared without protein and where the functional groups were neutralized with Tris was used as a control for nonspecific binding to the resin. Disposable columns containing either control or MltA-coupled resin were prepared and equilibrated with 20 col. vol. buffer I. Solu-bilized membrane extract was applied to both columns at a flow rate of 0.25 mLÆmin)1, then washed with 5 · 1.0 mL buffer I. Retained proteins were eluted by increasing the NaCl concentration in a stepwise fashion. Salt concentra-tionsof300 mM,600 mM and1.0 M inbuffer Iwereapplied in 5 · 1.0 mL aliquots, and the eluates retained for analysis by SDS/PAGE, penicillin-binding assay, and Western blot. Penicillin-binding assay Penicillin-binding proteins (PBPs) were identified using the 125I-labelled Bolton–Hunter derivative of ampicillin pre-pared as described previously [21]. Briefly, 4 lL (2.4 lg total) of the labelled ampicillin derivative was incubated for 30 min at 37 °C with 40 lL of the fractions eluted from control and MltA-coupled affinity columns. The reaction was stopped by the addition of 4 lL penicillin G (60 mgÆmL)1), and the reaction complexes separated by SDS/PAGE and visualized by autoradiography. Preparation of antisera to PBP2 Recombinant PBP2 from N. gonorrhoeae was purified as a soluble, active form. PBP2 was expressed in the cytoplasm of E. coli as a fusion protein to maltose-binding protein (MBP) with a His6 tag at its N-terminus. Codons 44–581, which encode the entire periplasmic domain of PBP2, were fused in-frame to the C-terminus of MBP via an interven-ing tobacco etch virus (TEV) protease site. The fusion protein was overexpressed in E. coli, purified on a Ni2+/ nitrilotriacetate column, and cleaved with His6–TEV protease (fusion protein/TEV protease, 20 : 1, w/w) in 50 mM Tris/HCl (pH 8.0)/500 mM NaCl/10% glycerol. After digestion, PBP2 was again purified by metal chelate affinity chromatography to remove uncut fusion protein, His6–MBP and the protease. PBP2 was not eluted in the flow through, which contained unrelated contaminant proteins, but was eluted from the column with 10 mM imidazole. Purified PBP2 was judged to be at least 95% pure by SDS/PAGE. The protein was concentrated to 6 mgÆmL)1 and stored at )80 °C. Purified PBP2 was used to immunize mice, and antisera were collected as described b y Pizzaet al. [1]. Western blot Fractions eluted from the MltA-coupled affinity column were separated by discontinuous SDSPAGE using a 12.5% separating gel [15]. Proteins were electroblotted onto a nitrocellulose membrane and probed with antisera to PBP2 diluted 1 : 1000. Immunoreactive proteins were detected using the enhanced chemiluminescent method (Amersham, Chicago, IL, USA) and fluorography. 3726 G. T. Jennings et al. (Eur. J. Biochem. 269) Ó FEBS 2002 RESULTS Cloning and expression in E. coli Expression of MltA in E. coli was observed when the gene was cloned with either its own 20-amino-acid LPSS or the 19-amino-acid LPSS from an unrelated Meningo-coccus lipoprotein, GNA1946. However, the level of expression was much lower when the native leader peptide was used (result not shown). Hence, for purposes of purification and characterization, we used the clone incorporating the LPSS from GNA1946. MltA cloned without a leader peptide was expressed very efficiently and represented about 20% of total cellular protein as judged by densitometry. This truncated, soluble form of the protein was used for affinity chromatography (see below). MltA incorporating the LPSS from GNA1946 was routinely expressed at 30 °C because expression of the recombinant protein at 37 °C resulted in lysis of host cells. Lysis at 37 °C was observed within 60 min of induction of expression and could be prevented by the addition of 12% (w/v) sucrose and 10 mM MgSO4. Overexpression of E. coli MltA also results in formation of spheroplasts and cell lysis [9]. However, in contrast with our results, lysis due to overexpression of E. coli MltA occurs at 30 °C, but not at 37 °C. With E. coli MltA, this effect is due to the temperature sensitivity of its muramidase activity, which exhibits maximum activity at 30 °C and a 93% reduction in activity at 37 °C. It also has been reported that a 55-fold overexpression of E.coli lytic transglycosylase MltB resulted in rapid cell lysis at 37 °C [8]. Similar to our observation with Meningococcus MltA, autolysis induced by overexpression of E. coli MltB was also prevented by osmotic protection during growth. Purification of recombinant proteins Recombinant MltA lipoprotein was purified from the membrane fraction of E. coli as described in Experimen-tal Procedures. Analysis of the purification by SDS/ PAGE showed that MltA lipoprotein was localized in the membrane fraction (Fig. 2, lane 2). Western-blot analysis with polyclonal sera raised against MltA failed to detect MltA in any of the soluble fractions obtained before Chaps extraction, demonstrating exclusive local-ization of the lipoprotein to the membrane fraction (result not shown). After solubilization of MltA with Chaps, it was necessary to maintain NaCl at a minimum concentration of 120 mM to prevent the lipoprotein from precipitating. The predicted pI for MltA is 10.5. The basic nature of the protein enabled FPLC cation-exchange chromatography to be performed under condi-tions that allowed almost complete removal of contam-inating proteins in a single step (Fig. 2, lane 4). Similarly, this property was exploited to perform a simple two-step procedure for the purification of the truncated version of MltA, which involved salting out and cation exchange. The leaderless form is found exclusively in the cytosolic fraction of E. coli and was purified to homogeneity as judged by SDS/PAGE with Coomassie blue staining (Fig. 2, lane 5). Fig. 2. SDS/polyacrylamide gel showing the purification and molecular mass of recombinant forms of MltA. Proteins were separated by SDS/ PAGEona12.5%separatinggelandstainedwithCoomassieBrilliant Blue. Lane M, molecular-mass standards; lane 1, bacterial lysate after expression; lane 2, membrane fraction after 100 000 g centrifugation; lane 3, soluble fraction after extraction of membrane fraction with 0.5% CHAPS; lane 4, an aliquot from the peak fraction from Mono S FPLC ion-exchange chromatography; lane 5, truncated MltA (expressed without the LPSS) after Mono S FPLC ion-exchange chromatography. Molecular mass The molecular masses of the lipoprotein and truncated forms of MltA were determined under denaturing condi-tions by SDS/PAGE (Fig. 2). The two forms of the protein migrate to the same position in the gel (Fig. 2), and, from a calibration plot of log mass vs. relative mobility of protein standards, the masses of both forms of MltA were calculated to be 44.5 kDa. This is in agreement with the molecular mass of 45 869 Da predicted from the amino-acid composition of the protein excluding the first 19-amino-acids of the leader peptide. As the lipoprotein expressed with its 2138-Da leader sequence migrates to the same position as leaderless MltA, it is reasonable to conclude that the signal peptide is cleaved when this clone is expressed. The presence of detergent in the purification prevented an accurate estimation of molecular mass for MltA lipoprotein using molecular exclusion chromatogra-phy.AstruncatedMltAlackingitsLPSSwaspurifiedinthe absence of detergent, we determined the native molecular mass using this form of the protein (see Experimental ... - tailieumienphi.vn