Xem mẫu

  1. BỘ GIÁO DỤC VÀ ĐÀO TẠO BỘ NÔNG NGHIỆP VÀ PTNT VIỆN KHOA HỌC NÔNG NGHIỆP VIỆT NAM PHẠM THÙY DƢƠNG NGHIÊN CỨU TUYỂN CHỌN VI KHUẨN BACILLUS THURINGIENSIS PHỤC VỤ TẠO CHẾ PHẨM DIỆT CÔN TRÙNG BỘ HAI CÁNH (DIPTERA) Chuyên ngành: Công nghệ sinh học Mã số : 9 42 02 01 TÓM TẮT LUẬN ÁN TIẾN SĨ NÔNG NGHIỆP Hà Nội – 2019
  2. Công trình đƣợc hoàn thành tại: VIỆN KHOA HỌC NÔNG NGHIỆP VIỆT NAM Ngƣời hƣớng dẫn khoa học: Thầy hƣớng dẫn 1: PGS.TS. Ngô Đình Bính Thầy hƣớng dẫn 2: TS. Lê Đức Khánh Phản biện 1: …………………………… Phản biện 2:……………………………. Phản biện 3:……………………………. Luận án sẽ đƣợc bảo vệ trƣớc Hội đồng chấm luận án cấp nhà nƣớc họp tại: …………………………………………………………………… …………………………………………………………………… Vào hồi giờ ngày tháng năm Có thể tìm hiểu luận án tại thƣ viện: - Thƣ viện Quốc gia Việt Nam - Thƣ viện Viện Khoa học Nông nghiệp Việt Nam
  3. MỞ ĐẦU 1. Tính cấp thiết của đề tài Bacillus thuringiensis là vi khuẩn có khả năng sinh sản ra các protein tinh thể độc có khả năng diệt côn trùng thuộc các bộ khác nhau mà không gây độc hại cho con ngƣời và môi trƣờng sinh thái và sinh vật có ích. Trong nhiều năm qua, thuốc trừ sâu sinh học từ vi khuẩn Bacillus thuringiensis đã đƣợc nghiên cứu và ứng dụng để diệt trừ côn trùng có hại đối với cây trồng cũng nhƣ bảo vệ sức khỏe cộng đồng. Thuốc trừ sâu sinh học từ vi khuẩn Bacillus thuringiensis càng đƣợc sử dụng một cách rộng rãi bởi nhu cầu sử dụng các sản phẩm nông nghiệp sạch ngày càng cao. Côn trùng bộ hai cánh là một trong những bộ lớn trong lớp côn trùng với số lƣợng và thành phần đa dạng. Côn trùng thuộc bộ hai cánh rất đa dạng về mặt sinh thái học và chủ yếu là các tác nhân gây hại trong nông nghiệp (ruồi đục quả) hay cho con ngƣời nhƣ ruồi, muỗi. Chúng là tác nhân trung gian chủ yếu truyền bệnh giữa ngƣời với ngƣời hay giữa động vật và ngƣời. Các bệnh do muỗi truyền có thể gây tử vong cao nhƣ Anopheles gambiae là trung gian truyền bệnh sốt rét cho ngƣời. Aedes aegypti truyền bệnh sốt xuất huyết. Culex tritaeniorhynchus truyền bệnh viêm não Nhật Bản còn ruồi là tác nhân truyền khoảng 100 bệnh nhƣng chủ yếu là các bệnh nguy hiểm nhƣ: bại liệt, bệnh đau mắt hột, viêm gan (A, E), sốt hồi qui do Rickettsiae, lỵ, tả, thƣơng hàn, liên cầu khuẩn (Streptococcus) và tụ cầu vàng (Staphyloccocus). Ngày nay, có nhiều phƣơng pháp diệt côn trùng bộ hai cánh khác nhau mà con ngƣời áp dụng. Biện pháp diệt đƣợc sử dụng phổ biến nhất là dùng các loại thuốc diệt ruồi, muỗi. Tuy nhiên, những loại thuốc này hiện nay thƣờng có giá thành cao, chủ yếu có nguồn gốc từ hóa chất nên dễ gây ô nhiễm môi trƣờng và ảnh hƣởng đến sức khỏe của con ngƣời, động vật, không diệt trừ tận gốc mầm bệnh. Việc nghiên cứu hoạt tính diệt ấu trùng một số côn trùng bộ hai cánh của các chủng Bacillus thuringiensis phân lập ở Việt Nam là rất cần thiết nhằm tìm ra những chủng mang gen tự nhiên có hoạt tính mạnh phục vụ sản xuất chế phẩm sinh học diệt ấu trùng một số côn trùng bộ hai cánh. Xuất phát từ thực tiễn trên chúng tôi tiến hành nghiên cứu đề tài: “Nghiên cứu tuyển chọn vi khuẩn Bacillus thuringiensis phục vụ tạo chế phẩm diệt côn trùng bộ hai cánh (Diptera)” 1
  4. 2. Mục tiêu nghiên cứu 2.1. Mục tiêu chung Tuyển chọn đƣợc chủng Bacillus thuringiensis bản địa có khả nãng sinh protein tinh thể độc diệt côn trùng thuộc bộ Hai cánh (Diptera) cao. Biểu hiện, tinh sạch đƣợc protein mã hóa tinh thể độc diệt côn trùng bộ hai cánh trong vi khuẩn phục vụ nghiên cứu chuyên sâu. Và sản xuất đƣợc chế phẩm sinh học Bacillus thuringiensis có hoạt lực diệt ấu trùng ruồi nhà (Musca domestica) từ bã thải nhà máy bia . 2.2. Mục tiêu cụ thể - Sàng lọc và thu nhận đƣợc chủng vi khuẩn Bacillus thuringiensis từ các mẫu đất, lá tại một số tỉnh của Việt nam có khả năng sinh gen cry2A mã hóa protein tinh thể độc diệt côn trùng bộ hai cánh và xác định đƣợc trình tự nucleotide của gen cry2A này. - Biểu hiện và tinh sạch đƣợc protein tái tổ hợp (rCry2A) trong E.coli BL 21 (DE3). - Tìm ra đƣợc phƣơng pháp xử lý bã malt bia làm môi trƣờng nuôi cấy vi khuẩn B. thuringiensis và nghiên cứu các yếu tố ảnh hƣởng đến sinh trƣởng và sinh tổng hợp protein tinh thể của vi khuẩn B. thuringiensis khi sử dụng bã malt bia làm môi trƣờng nuôi cấy ở quy mô phòng thí nghiệm. Đồng thời đánh giá đƣợc sơ bộ hiệu quả diệt côn trùng bộ hai cánh của chế phẩm BT từ vi khuẩn B. thuringiensis 3. Nội dung nghiên cứu - Phân lập và nghiên cứu đặc điểm sinh học của một số chủng Bacillus thuringiensis (Bt) có hoạt tính diệt côn trùng bộ hai cánh. - Nghiên cứu tách dòng và đọc trình tự đƣợc gen cry2 của các chủng Bt phân lập từ đất, lá có hoạt tính diệt côn trùng bộ hai cánh của chủng vi khuẩn B. thuringiensis tuyển chọn. - Nghiên biểu hiện gen mã hóa protein Cry2 diệt côn trùng bộ hai cánh của chủng vi khuẩn B. thuringiensis tuyển chọn. - Nghiên cứu các phƣơng pháp xử lý bã malt bia làm môi trƣờngnuôi cấy vi khuẩn B. thuringiensis. Hoàn thiện môi trƣờng lên men vi khuẩn B. thuringiensis từ bã malt bia. - Nghiên cứu các yếu tố ảnh hƣởng đến sinh trƣởng và sinh tổng hợp protein tinh thể của vi khuẩn B. thuringiensis tuyển chọn khi sử dụng bã malt bia làm môi trƣờngnuôi cấy ở quy mô phòng thí nghiệm. - Lên men sản xuất chế phẩm sinh học diệt côn trùng bộ hai cánh từ vi khuẩn B. thuringiensis tuyển chọn và đánh giá sƣ bộ hiệu quả diệt côn trùng bộ hai cánh của chế phẩm trong phòng thí nghiệm và ngoài thực địa. 2
  5. 4. Những đóng góp mới của luận án - Phân lập và tuyển chọn đƣợc 7 chủng vi khuẩn B. Thuringiensis mang gen cry2A có hoạt tính diệt côn trùng bộ hai cánh cao. - Luận án là công trình đầu tiên ở Việt Nam nghiên cứu một cách có hệ thống về gen cry2A từ chủng vi khuẩn B. thuringiensis serovar kurstaki MSS 8.4 của Việt Nam có khả năng diệt côn trùng bộ hai cánh phục vụ cho việc phát triển thuốc trừ sâu sinh học. - Bổ sung cơ sở dữ liệu nguồn gen cry2A của các chủng B. thuringiensis Việt Nam phục vụ cho các nghiên cứu và ứng dụng về sau. - Sử dụng bã malt bia là một chất thải của ngành sản xuất đồ uống làm nguồn nguyên liệu cung cấp các chất dinh dƣỡng (các bon, nitơ, chất khoáng…) cho sự sinh trƣởng của vi khuẩn B. thuringiensis và đƣợc sử dụng nhƣ một nguyên liệu thay thế cho các hợp chất hữu cơ tổng hợp đắt tiền để sản xuất thuốc trừ sâu sinh học BT. . 5. Ý nghĩa khoa học và thực tiễn của đề tài 5.1. Ý nghĩa khoa học Nghiên cứu một cách hệ thống và đầy đủ về gen cry2A là cơ sở khoa học đáng tin cậy cho những nghiên cứu tiếp theo về vi khuẩn Bacillus thuringiensisnói chung và gen cry2A nói riêng. Trên cơ sở đánh giá đƣợc tác động của gen cry2A mã hóa protein tinh thể có khả năng diệt đƣợc một số côn trùng bộ hai cánh nhƣ ruồi nhà là một bƣớc đi mới để mở ra khả năng tạo ra đƣợc các chế phẩm sinh học diệt các côn trùng này. 5.2. Ý nghĩa thực tiễn Kết quả của luận án góp phần khai thác có hiệu quả nguồn gen của vi sinh vật nói chung và gen cry2A của vi khuẩn Bacillus thuringiensis nói riêng để góp phần tạo ra các chế phẩm sinh học diệt một số côn trùng bộ hai cánh. Mặt khác sử dụng bã malt bia - một loại chất thải của ngành sản xuất công nghiệp đƣợc xử lý thành nguồn nguyên liệu cho quá trình sản xuất khác chế phẩm BT là rất cần thiết. Đây là một hƣớng nghiên cứu nhằm nâng cao giá trị của bã malt bia, tạo ra sản phẩm thân thiện môi trƣờng phục vụ sản xuất nông nghiệp bền vững. 6. CẤU TRÚC CỦA LUẬN ÁN Luận án dày 149 trang (không kể phần Tài liệu tham khảo và Phụ lục) đánh máy vi tính khổ A4 với 23 bảng, 43 hình. Luận án gồm 5 phần: Mở đầu (04 trang); Tổng quan tài liệu (40 trang); Vật liệu, nội dung và phƣơng pháp nghiên cứu (19 trang); Kết quả nghiên cứu và thảo luận (60 trang); Kết luận và kiến nghị (02 trang). Đã tham khảo 146 tài liệu tham khảo bao gồm 20 tài liệu tiếng Việt và 126 tài liệu tiếng Anh. 3
  6. CHƢƠNG 1 TỔNG QUAN TÀI LIỆU VÀ CƠ SỞ KHOA HỌC CỦA ĐỀ TÀI Luận án đã tham khảo và tóm lƣợc các tài liệu tiếng Anh và tiếng Việt, với 6 nội dung liên quan gồm: Vi khuẩn Bacillus thuringiensis; Gen cry2; Hệ biểu hiện E. coli; Côn trùng thử nghiệm; Thuốc trừ sâu sinh học Bacillus thuringiensis; Tổng quan về bã Malt bia; Trong đó, Bacillus thuringiensis (B. thuringiensis) là vi khuẩn đất, gram dƣơng. Trong quá trình sinh trƣởng và phát triển B. thuringiensis có khả năng sinh ra 3 loại độc tố diệt côn trùng chính là Cry (crystal δ-endotoxin), Cyt (cytolysin) và Vip (vegetative insecticidal protein). Các gen cry2 mã hóa protein tinh thể khoảng 65 – 71 kDa, đƣợc sản sinh bởi một số phân loài của B. thuringiensisnhƣ: kurstaki (HD-1, HD-263, NRD-12 và 14 dòng khác), thurigiensis, tolwwarthi, israelensis, kenyae… (Dwu và cộng sự, 1991; Ohba và Aizawa, 1986; Yamamoto, 1983). Cho đến nay, hơn 80 gen cry2 đã đƣợc phát hiện (http://www.lifesci.sussex.ac.uk/home/Neil_Crickmore/B. thuringiensis/toxins2.html). Ruồi và muỗi là loài động vật chân khớp ký sinh, thuộc lớp Côn trùng (Insecta), bộ Hai cánh (Diptera). Chúng là tác nhân trung gian truyền nhiều bệnh nguy hiểm giữa ngƣời với ngƣời hay giữa động vật và ngƣời. Thêm nữa, điều kiện thời tiết, khí hậu ở Việt Nam rất thuận lợi cho sự phát triển của chúng. Có nhiều phƣơng pháp diệt côn trùng bộ hai cánh khác nhau mà con ngƣời áp dụng. Biện pháp diệt đƣợc sử dụng phổ biến nhất là dùng các loại thuốc diệt ruồi, muỗi. Tuy nhiên, những loại thuốc này hiện nay thƣờng có giá thành cao, chủ yếu có nguồn gốc từ hóa chất nên dễ gây ô nhiễm môi trƣờng và ảnh hƣởng đến sức khỏe của con ngƣời, động vật, không diệt trừ tận gốc mầm bệnh. Những điểm chính này đã đƣợc trình bày trong Chƣơng 1. Qua đó, có thể thấy việc nghiên cứu hoạt tính diệt ấu trùng một số côn trùng bộ hai cánh của các chủng B. thuringiensis phân lập ở Việt Nam là rất cần thiết nhằm tìm ra những chủng mang gen tự nhiên có hoạt tính mạnh phục vụ sản xuất chế phẩm sinh học diệt ấu trùng một số côn trùng bộ hai cánh. CHƢƠNG 2 VẬT LIỆU, NỘI DUNG VÀ PHƢƠNG PHÁP NGHIÊN CỨU 2.1. Vật liệu nghiên cứu Các mẫu đất, lá dùng để phân lập vi khuẩn Bacillus thuringiensis đƣợc lấy từ các vùng Điện Biên, Hà Nội, Nghệ An, Nha Trang (Khánh Hòa), Lâm Đồng, TP Hồ Chí Minh, Kiên Giang. Bã malt bia đƣợc lấy từ nhà máy bia Sài Gòn- Hà Nội thuộc khu công nghiệp vừa và nhỏ quận Bắc Từ Liêm. 4
  7. Ấu trùng ruồi nhà tuổi 2; ruồi đục quả đƣợc nhận từ bộ môn Côn trùng- Viện Bảo vệ thực vật. Ấu trùng muỗi Anopheles minimus, Aedes aegypti, Culex quinquefasciatus do Viện sốt rét ký sinh trùng Trung ƣơng cung cấp. Chủng vi khuẩn E. coli DH5α dùng cho tách dòng gen và chủng vi khuẩn E.coli BL21 dùng để biểu hiện gen của hãng Invitrogen. Chủng B.thuringiensis 4D4 có nguồn gốc từ Bộ sƣu tập Bacillus thuringiensis của đại học Colombus, bang Ohio, Hoa Kỳ Trình tự cặp mồi khuếch đại gen cry2A Vị trí Kích Tên mồi Trình tự nhận thƣớc biết (bp) Cry2AaF TAAGGATCCGATGAATAATGTATTGAATAGTGGAAGA BamHI 1902 Cry2AaR ATTCTCGAGATAAAGTGGTGGAAGATTAGTTGG XhoI Hệ vector Vector pET22b (+) của hãng Novagen, vector pGEM-T đƣợc đóng gói kèm trong bộ kit pGEM®-T Easy Vector Systems của hãng Promega, TA Cloning® Kit with pCR™2.1 vector (Thermosciencetific). 2.2. Địa điểm và thời gian thực tập Các thí nghiệm đƣợc thực hiện tại phòng thí nghiệm Trung tâm Giống và Bảo tồn nguồn gen Vi sinh vật, Viện Công nghệ Sinh học, phòng Vi sinh môi trƣờng- Viện Công nghệ Môi trƣờng, Bộ môn Côn trùng – Viện Bảo vệ thực vật, Phòng thí nghiệm của Khoa Công nghệ Sinh học và Môi trƣờng-Trƣờng Đại học Phƣơng Đông. Thời gian thực hiện thí nghiệm từ tháng 6/2012-T12/2016. 2.3. Phƣơng pháp nghiên cứu 2.3.1. Phƣơng pháp vi sinh Phương pháp phân lập vi khuẩn Bacillus thuringiensis Vi khuẩn B. thuringiensis đƣợc phân lập các mẫu đất, mẫu lá thu thập đƣợc theo phƣơng pháp của Thiery và Frachon (1997). Phân loại vi khuẩn B. thuringiensis bằng phương pháp huyết thanh miễn dịch 2.3.2. Phƣơng pháp thử hoạt tính sinh học Định lượng mật độ bào tử, tinh thể Chủng B. thuringiensis phân lập đƣợc đƣợc đem cấy thảm trên đ a peptri chứa môi trƣờng MPA. Số lƣợng bào tử đƣợc tính theo công thức (Ohba và cộng sự, 1986) Xác định LC50 đối với côn trùng thử nghiệm Thử nghiệm khả năng diệt ấu trùng bộ Hai cánh trên đối tƣợng ấu trùng ruồi nhà Musca domestica, ấu trùng ruồi đục quả tuổi hai, ấu trùng muỗi theo phƣơng pháp của Thiery và Frachon ở hai nồng độ là 107 và 109 bào tử/ml với 5
  8. ruồi nhà, ruồi đục quả và 108 và 106 bào tử/ml với muỗi. Mỗi nồng độ đƣợc thử nghiệm với 3 cốc nhựa (mỗi cốc 10 ấu trùng). Tỉ lệ ấu trùng chết đƣợc tính theo công thức Abbott (Abbott, 1925). 2.3.3. Phƣơng pháp sinh học phân tử Phương pháp tách chiết DNA plasmid từ vi khuẩn DNA plasmid của vi khuẩn đƣợc tách chiết và tinh sạch Y bằng kit Gen TM JET Plasmid Miniprep (Fermentas). Phương pháp PCR khuếch đại gen cry2A Sinh tổng hợp DNA đƣợc tiến hành bằng kỹ thuật PCR (Polymerase Chain Reaction) (Sambrook, 2001). Phương pháp tách dòng gen cry2 Cắt DNA bằng enzyme cắt giới hạn. Ghép nối DNA bằng T4 DNA ligase. Biến nạp plasmid tái tổ hợp vào E. coli DH5α. Phương pháp điện di trên gel agarose DNA đƣợc phát hiện và định lƣợng tƣơng đối bằng kỹ thuật điện di trên gel agarose theo phƣơng pháp của Sambrook & Russel, 2001. Tinh sạch DNA từ gel agarose Sản phẩm DNA đƣợc tinh sạch từ gel agarose bằng bộ kít GenJETTM Gel Extraction (Fermentas) theo quy trình hƣớng dẫn của nhà sản xuất. Phương pháp xác định trình tự nucleotit của đoạn gen đã tách dòng Trình tự DNA đƣợc xác định theo phƣơng pháp của Sanger và cộng sự. Mẫu DNA đƣợc gửi đọc trình tự tại hãng Microgen, Hàn Quốc sử dụng cặp mồi M13. Xử lý kết quả đọc trình tự bằng phần mềm Bioedit, so sánh trình tự gen đã tách dòng với các trình tự đã công bố trong Ngân hàng Gen Quốc tế tại địa chỉ online: https://blast.ncbi.nlm.nih.gov/Blast.cgi. Thiết kế vector biểu hiện Sử dụng vector pET22 b(+) làm vector biểu hiện. Gen cry2A đƣợc đƣa vào vector pET 22b(+) tại vị trí BamHI và XhoI. Trình tự amino acid của protein tái tổ hợp gồm toàn bộ trình tự amino acid của gen cry2A tự nhiên thêm 6amino acid Histidine ở đầu C và 36 amino acid đầu N. Phương pháp biểu hiện gen Cấy hoạt hoá 1 khuẩn lạc trong môi trƣờng LB có bổ sung ampicilin với nồng độ cuối là 50 g/ ml, nuôi lắc ở 370C qua đêm. Sau đó cấy chuyển 1% vào 20 ml môi trƣờng MPB có bổ sung kháng sinh ampicilin nồng độ là 50 g/ ml và nuôi lắc ở 370C để OD đạt 0,5-0,8. Cảm ứng IPTG (100 mM) đạt 1mM, nuôi ở 370C trong 4h. Điện di trên gel polyacrylamide 12,6% để kiểm tra sản phẩm biểu hiện. Phương pháp điện di trên gel polyacrylamide 12,6 % theo phƣơng pháp của Hoefer và cộng sự (1994). 6
  9. Phương pháp Western blot Mẫu protein sau khi kiểm tra bằng SDS-PAGE trên gel acryamide 12% sẽ đƣợc chuyển lên màng PVDF. Mẫu protein sẽ đƣợc ủ với kháng thể đặc hiệu và kháng thể phát hiện. Sau đó phát hiện bằng dung dịch chứa cơ chất cho peroxidase (Sigma). Phương pháp tinh sạch protein tái tổ hợp Protein tái tổ hợp đƣợc tinh sạch bằng cột sắc ký Ni2+ agarose theo quy trình hƣớng dẫn của hãng Invitrogen. 2.3.4. Tối ƣu hóa môi trƣờng lên men theo phƣơng pháp đáp ứng bề mặt Chuẩn bị dịch giống Khuẩn lạc đƣợc nuôi trên môi trƣờng MTCS vô trùng. Nuôi lắc ở 30oC, 200 vòng/phút, thời gian nhân giống 8-10 giờ. Dịch nuôi cấy (chứa các tế bào đang ở giai đoạn sinh trƣởng) đƣợc sử dụng để làm giống cho các thí nghiệm tiếp theo (Adjiable và cộng sự, 2009; Yezza và cộng sự, 2006). Phương pháp lên men vi sinh vật Lên men vi khuẩn Bacillus thuringiensis trong bình tam giác Lên men trong bình tam giác 500 ml ở nhiệt độ 30±0,1oC, tốc độ lắc 200 vòng/phút, thời gian nuôi 48h (Yezza và cộng sự, 2006). Lên men trong thiết bị lên men 10 lít Đƣa 10 lít môi trƣờng vào bình lên men, khử trùng ở 121oC, 1 at, trong vòng 30 phút, làm nguội về nhiệt độ phòng, lắp bình lên men vào thiết bị lên men. Cài đặt các thông số lên men: nhiệt độ 30±0, 1oC, pH7±0,1, tốc độ khuấy 300 vòng/phút, DO>25 mg/l, tốc độ thổi khí 2-4 lít/phút (Lƣơng Đức Phẩm, 2008; Avigone và cộng sự, 1992) Thủy phân bã bia Bã bia sau khi lấy về phòng thí nghiệm đƣợc xay nhỏ và xử lý làm nguyên liệu nuôi cấy vi sinh vật bằng phƣơng pháp nhiệt phân kết hợp thay đổi pH (Nguyễn Thị Vân Trang và cộng sự, 2012; Valo và cộng sự, 2004). Bố trí thí nghiệm Dịch thủy phân bã bia sau xử lý đƣợc đƣa đi phân tích thành phần hóa học theo các phƣơng pháp tiêu chuẩn. Trong đó TOC đƣợc xác định bằng phƣơng pháp SMEWW 5310B-2005; TN, TP đƣợc xác định bằng phƣơng pháp EPA-352.1 và EPA-365.2, thành phần kim loại đƣợc xác định theo phƣơng pháp SMEWW 3125-2005. (Adjiable và cộng sự, 2009) Nghiên cứu ảnh hưởng của nồng độ chất rắn lên quá trình sinh trưởng và sinh tổng hợp protein tinh thể của chủng MSS8.4 Xác định nguồn dinh dưỡng bổ sung vào dịch thủy phân bã bia Đánh giá tác động độc lập của các yếu tố dinh dưỡng đến sinh trưởng và sinh protein tinh thể 7
  10. Tối ưu hóa thành phần môi trường bằng phương pháp đáp ứng bề mặt Tối ưu hóa thành phần môi trường bằng phương pháp đáp ứng bề mặt Tối ƣu thành phần môi trƣờng theo phƣơng pháp đáp ứng bề mặt đƣợc mô tả đƣợc thực hiện theo phƣơng pháp của Rajesh và cộng sự (2012). Sau khi xác định đƣợc khoảng tác động của từng yếu tố đến sự sinh trƣởng và sinh tổng hợp protein của MSS8.4, nhập dữ liệu vào phần mềm Design expert 10.1. Xử lý số liệu CHƢƠNG 3 KẾT QUẢ NGHIÊN CỨU VÀ THẢO LUẬN 3.1. Phân lập và lựa chọn chủng hiệu lực kháng côn trùng bộ hai cánh từ các chủng Bacillus thuringiensis 3.1.1. Phân lập các chủng Bacillus Để phân lập và tuyển chọn đƣợc chủng B. thuringiensis có hoạt tính diệt côn trùng bộ 2 cánh (Diptera), 317 mẫu đất, lá đã đƣợc thu thập tại 7 tỉnh thành từ 7 vùng địa lý của Việt Nam. Các địa điểm này trƣớc đó chƣa từng sử dụng các chế phẩm sinh học. Trong 317 mẫu đất, lá thí nghiệm có 198 mẫu mang vi khuẩn Bacillus và 119 mẫu không phân lập đƣợc B. thuringiensis. Nhƣ vậy tần suất xuất hiện của Bacillus là 62,4%. Những khu vực có tỉ lệ Bacillus cao trong mẫu: Kiên Giang (75,0%), Điện Biên (72,8%) và Hà Nội (72,8%); thấp nhất là Nghệ An (33,3%). Trong số 1.020 khuẩn lạc với các đặc điểm thuộc chi Bacillus, có 440 khuẩn lạc thuộc nhóm B. thuringiensis dựa trên khả năng hình thành tinh thể (chiếm 43%). Tỉ lệ này phụ thuộc vào số mẫu lấy đƣợc ở các tỉnh, cao nhất ở các mẫu đƣợc thu thập ở Hà Nội (54%) và thành phố Hồ Chí Minh (53%), thấp nhất ở mẫu thu thập ở Lâm Đồng (25%), các tỉnh Điện Biên và Kiên Giang cho tỉ lệ tƣơng đƣơng nhau (42% và 44%). Các mẫu đất đƣợc thu thập tại 7 vùng địa lý của Việt Nam có tần suất Bt cao hơn so với những công bố trƣớc đây (Martin và Travers, 1989; Binh và cộng sự, 2005). Tần suất Bt trong nghiên cứu này là 62,4% điều này hoàn toàn phù hợp với các công bố trƣớc đây của Martin và Travers (1989), trong mẫu đất của New Zealand (Chilcott và Wigley, 1993), trong mẫu đất của Hàn Quốc ( Lee và cộng sự, 1995) và trong mẫu đất của nhật Bản (Ohba và Aizawa, 1986). Sự xuất hiện của Bt hầu nhƣ khắp nơi trong môi trƣờng sống, bao gồm: đất nông nghiệp, đất rừng, đất đô thị, đất ngập mặn, thậm chí cả sa mạc (Dulmage và Aizawa,1982; Martin và Travers, 1989; Zhang và cộng sự, 2000; Uribe và cộng sự, 2003). Trong nghiên cứu này, sự xuất hiện của Bt tập trung chủ yếu ở Hà Nội thuộc đất thành thị và có mật độ dân số cao. Kết quả này cao hơn nhiều so với nghiên cứu của Quesada-Moraga (Quesada-Moraga và cộng sự, 2004), phù hợp với kết quả của Ayyasamy (2012). Theo Ayyasamy, tỉ lệ Bt ở đất thành thị là 80%, tuy nhiên tần suất xuất hiện cao nhất ở đất nông nghiệp (Ayyasamy và 8
  11. cộng sự, 2012). Nhƣ vậy, so với số liệu công bố của các tác giả trên thì tần suất xuất hiện Bt và chỉ số Bt mà đề tài phân lập đƣợc là khá cao. Chứng tỏ số lƣợng vi khuẩn Bt ở Việt Nam rất phong phú, có thể cung cấp nhiều nguồn gen quý. 3.1.2. Nghiên cứu protein tinh thể 440 chủng B. thuringiensis đã phân lập thuộc 7 vùng địa lý của Việt Nam, đƣợc tiến hành nuôi cấy trên môi trƣờng MPA. Sau 3 ngày quan sát trực tiếp trên kính hiển vi quang học ở vật kính dầu với tiêu bản nhuộm bằng thuốc nhuộm fushin để xác định hình dạng tinh thể của các chủng vi khuẩn. Kết quả thu đƣợc cho thấy tất cả các chủng phân lập có khả năng sinh tinh thể ở tất cả các hình dạng. Có những chủng có khả năng sinh từ 1-3 loại tinh thể. Cụ thể, 186/440 chủng sinh tinh thể hình lƣỡng tháp chiếm 42,2%; 193/440 chủng sinh tinh thể hình cầu chiếm 43,8%; 46/440 chủng sinh tinh thể hình lập phƣơng chiếm 10,5%; 15/440 chủng sinh tinh thể hình không xác định chiếm 3,5%. Nghiên cứu về hình dạng tinh thể của các chủng Bt phân lập tại tỉnh Thành Đô - Trung Quốc có dạng hình tháp lƣỡng cực và hình cầu, chiếm tới 91,8% (Yu và cộng sự, 2015). Tuy nhiên, phần lớn cấu trúc tinh thể của các chủng Bt thu thập tại bang Tamil Nadu - Ấn Độ có dạng hình lập phƣơng (26,9%) và hình tháp lƣỡng cực (21,2%) (Ramalakshmi và Udayasuriyan, 2010). Kết quả quan sát hình dạng tinh thể của các chủng Bt thu thập ở Saudi Arabia kết luận, cấu trúc tinh thể dạng cầu chiếm tỉ lệ lớn (54%), sau đến là dạng không định hình (27%) và tháp lƣỡng cực (16%) (El-kresh và cộng sự, 2014). Sự đa dạng và khác biệt về hình dạng tinh thể của các chủng phân lập đƣợc trong nghiên cứu này cũng nhƣ trong các nghiên cứu khác có thể do sự khác nhau về đặc điểm sinh học của các chủng Bt cũng nhƣ đặc điểm protein Cry của các chủng thu thập đƣợc. Theo các tài liệu công bố trên thế giới, các chủng mang Gen cry2A rất đa dạng chúng có thể sinh ra từ các dƣới loài Bt. serovar kurstaki, Bt. serovar sotto, Bt.serovar israelensis, Bt.serovar kenyae có hình dạng tinh thể chủ yếu là hình cầu và hình lƣỡng tháp. Vì vậy, các chủng có khả năng sinh ra tinh thể hình cầu và hình lƣỡng tháp đƣợc lựa chọn để nghiên cứu phân loại và sàng lọc gen cry2A bằng phản ứng huyết thanh miễn dịch. Phân loại các chủng Bacillus thuringiensis b ng kit huyết thanh miễn dịch Thông qua phản ứng ngƣng kết với các typ huyết thanh, xác định đƣợc 32 chủng Bt (chiếm 71%), trong đó có 5 chủng thuộc dƣới loài Bt. serovar. kurstaki, 2 chủng Bt. serovar israelensis (Bảng 3.1). Bảng 3.1. Kết quả phân loại dƣới loài các chủng Bacillus thuringiensis b ng phƣơng pháp huyết thanh 9
  12. ST Dƣới loài Bacillus thuringiensis Typ Số chủng Tỷ lệ T huyết ngƣng kết (%) thanh 1 Bacillus thuringiensisserovar 14 2 6,25 israelensis 2 Bacillus thuringiensis serovar kurstaki 3a,3b 5 15,62 3 Bacillus thuringiensisserovar 3d 9 28,13 sumiyoshiensis 4 Bacillus thuringiensisserovar 25 4 12,5 coreanensis 5 Bacillus thuringiensis serovar 24a, 24b 2 6,25 neoleonensis 6 Bacillus thuringiensis serovar aizawai 7 5 15,63 7 Bacillus thuringiensis serovar 20a, 20b 1 3,13 yunnanensis 8 Bacillus thuringiensisserovar pakistani 13 3 9,38 9 Bacillus thuringiensis serovar 38 1 1,39 oswaldocruzi Tổng 32 100 Nghiên cứu của Martinez và cộng sự (2005) cho thấy, gen cry2 xuất hiện ở tất cả các chủng B. thuringiensisserovar kurstaki. Ngoài ra, chủng B. thuringiensisserovar israelensis cũng đƣợc tìm thấy phổ biến ở các môi trƣờng sống của muỗi (Martinez và Caballero, 2002). Do đó, các chủng thuộc nhóm này sẽ đƣợc đề tài lựa chọn cho các thí nghiệm tiếp theo. 3.1.3.Đánh giá khả năng diệt côn trùng bộ hai cánh của các chủng phân lập Để thử hoạt tính diệt ấu trùng bộ hai cánh (Diptera) của các chủng Bt thuộc dƣới loài B. thuringiensis serovar kurstaki và B. thuringiensis serovar israelensis pha loãng nồng độ bào tử đến mức 109 bào tử/ml và thử nghiệm với ấu trùng ruồi nhà tuổi hai, ấu trùng muỗi và ấu trùng ruồi đục quả. Bảng 3.2. Kết quả thử hoạt tính diệt ấu trùng bộ 2 cánh của các chủng Bt sau 3 và 5 ngày thử nghiệm Thử nghiệm với Thử nghiệm với Thử nghiệm với ấu trùng ruồi ấu trùng ruồi đục Tên chủng ấu trùng muỗi nhà quả Bacillus Tỉ lệ Tỉ lệ Tỉ lệ Tỉ lệ Tỉ lệ Tỉ lệ thuringiensis chết sau chết sau chết sau chết sau chết sau chết sau 3 ngày 5 ngày 3 ngày 5 ngày 5 ngày 7 ngày 10
  13. (%) (%) (%) (%) (%) (%) LD 2.21 66,67 90,33 83,33 100 - - LNT 7.12 66,67 96,67 83,33 100 16,67 33,33 LNT 16.6 73,33 83,33 86,67 100 13,33 16,67 MSS 1.1 50 100 66,67 83,33 3,33 10 MSS 4.2 46,67 78,67 60 76,67 0 10 MSS 6.3 63,33 98,33 80 100 13,33 20 MSS 8.4 80 100 93,33 100 20 33,33 4D4 6,67 30 16,67 30 0 0 - -Kết quả thử ấu trùng cho ta thấy, các chủng B. thuringiensis đƣợc tuyển chọn có khả năng diệt ấu trùng khá cao. T lệ ấu trùng chết tăng dần theo thời gian thí nghiệm. nồng độ 109 bào tử/ml các chủng đƣợc lựa chọn có t lệ ấu trùng chết đạt 76,67 - 100 % sau 5 ngày. Tuy nhiên, khả năng diệt ấu trùng ruồi đục quả là tƣơng đối thấp, chỉ đạt 0 – 33,33% sau 7 ngày thử nghiệm. - 3.2. Khẳng định sự có mặt của cry2A liên quan tới tính trạng diệt côn trùng bộ hai cánh ở các chủng phân lập 3.2.1. Phát hiện gen cry2A từ các chủng Bacillus thuringiensis đã phân loại huyết thanh b ng phƣơng pháp PCR Kết quả phát hiện gen cry2A bằng phƣơng pháp PCR cho thấy, 7 chủng thuộc 2 dƣới loài B. thuringiensis serovar kurstaki và B. thuringiensis serovar israelensis đều cho sản phẩm PCR có 1 băng với kích thƣớc khoảng 1,9 kb. 3.2.2. Tách d ng và đọc trình tự gen cry2A Gen cry2A từ hai chủng có hoạt tính diệt ruồi cao nhất đƣợc khuếch đại và gắn vào vector tách dòng pCR2.1, biến nạp vào tế bào E. Coli DH5α. Sau 14 - 16 giờ cấy trải lên môi trƣờng chọn lọc LB, Ampicilin 50 g/ml, o ở 37 C, tiến hành sàng lọc sơ bộ bằng kỹ thuật PCR trực tiếp từ khuẩn lạc. Từ 4 dòng tế bào mang gen của mỗi chủng sàng lọc bằng cặp mồi đặc hiệu, đều thu đƣợc đoạn kích thƣớc đúng nhƣ tính toán (khoảng 1,9 kb). Kết quả điện di sản phẩm cắt DNA plasmid của 3 dòng tế bào cũng cho 1 băng có kích thƣớc 3,9 kb và 1 băng có kích thƣớc 1,9 kb, đúng nhƣ kích thƣớc tính toán. Điều này chứng tỏ đoạn gen 1,9 kb đã đƣợc tách dòng thành công. DNA plasmid của các dòng đƣợc gửi đi đọc trình tự gen bằng máy đọc trình tự tự động (Macrogen, Hàn Quốc) sử dụng cặp mồi đặc hiệu. Trình tự nucleotide sau khi đọc trình tự đƣợc phân tích bằng phần mềm BioEdit ver 7.0.9. Các trình tự DNA này sau đó đƣợc so sánh và xác định mối quan hệ với các trình tự gen cry2A khác trên Ngân hàng Gen Quốc tế. Kết quả xây dựng cây phả hệ cho thấy trình tự thu đƣợc mã hoá cho gene 11
  14. thuộc nhóm cry2A, phân nhóm cry2Aa. Nhóm độc tố cry2Aa và cry4 đã đƣợc chứng minh có khả năng gây độc lên côn trùng thuộc bộ 2 cánh (Bravo, 1997). Trình tự DNA của của các gen cry2Aa này đƣợc căn đa chuỗi so sánh với các trình tự gen thuộc phân nhóm cry2Aa trên Ngân hàng Gen Quốc tế. Kết quả cho thấy trình tự đoạn gen cry2Aa từ chủng MSS8.4 có chiều dài 1902 bp và có độ tƣơng đồng là 99% với trình tự tƣơng ứng đã công bố trƣớc đây trên ngân hàng genvới 6 điểm sai khác: 305 (G-A), 500 (G-A), 783 (T-G), 1054 (T-G), 1303 (G-A), 1575 (C-T), chủng LNT7.12 có độ tƣơng đồng 100% với chủng công bố.Trình tự nucleotide của gen cry2Aa từ chủng MSS8.4 đƣợc đƣa lên Genbank với mã số là KM588296.1. So sánh trình tự amino axit (aa) suy diễn của 2 gen trên bằng công cụ so sánh BLAST trên NCBI cho thấy,trình tự axit amin của chủng LNT7.12 có độ tƣơng đồng hoàn toàn với chủng công bố, chủng MSS8.4 có độ tƣơng đồng 99% với các trình tự axit amin của Cry2A từ Bt với 5 vị trí sai khác (102 (S-N), 167 (R-Q), 261 (F-L), 352 (W-G), 435 (D-N)), đột biến nu ở vị trí 1575 (C-T) không làm thay thế axit amin. Điều này chứng tỏ rằng 2 gen cry đƣợc nhân dòng từ 2 chủng vi khuẩn MSS8.4 và LNT7.12 đều là gen mã hóa cho độc tố Cry2A, phân nhóm Cry2Aa. Cấu trúc của độc tố Cry2A từ chủng MSS8.4 đƣợc so sánh với những trình tự của Cry2Aa từ những chủng B. thuringiensis đã biết trƣớc đó cho thấy, có độ tƣơng đồng cao (99%) so với Cry2Aa từ chủng Bacillus thuringiensis serovar kurstaki (Pdb_id 1: 1I5P_A) đƣợc Morse và cộng sự xác định bằng sự nhiễu xạ tia X (Morse, 2001). Cry2Aa từ MSS8.4 đƣợc chia làm 3 vùng cấu trúc: Endotoxin đầu N gồm 210 a.a (Val-53 đến Lys-263); tiếp theo là Endotoxin vùng giữa gồm 205 a.a (Leu-267 đến Asn-472); cuối cùng là vùng Endotoxin đầu C gồm 224 a.a (Từ Phe-494 đến Asn-628). Kết quả này một lần nữa khẳng định gen tách dòng là gen mã hóa cho protein độc tố Cry2A, phân nhóm Cry2Aa. 3.2.3. Biểu hiện gen 3.2.3.1. Tạo chủng tái tổ hợp mang gen cry2A trong vi khuẩn E. coli BL21 (DE3) Để khẳng định xem khả năng diệt côn trùng có phải đƣợc quy định bởi gen cry2A hay không, gen cry2A từ chủng MSS8.4 tiếp tục đƣợc sử dụng để biểu hiện ra protein độc tố Cry2A và kiểm tra khả năng diệt côn trùng của protein tái tổ hợp. 5 khuẩn lạc ngẫu nhiên đƣợc kiểm tra bằng kỹ thuật PCR trực tiếp từ khuẩn lạc với cặp mồi đặc hiệu. Kết quả cho thấy 4 dòng xuất hiện băng DNA có kích thƣớc khoảng 1,9 kb. Kết quả kiểm tra bằng phản ứng cắt mở vòng với 2 enzym BamHI và XhoI cũng thể hiện đã tạo thành công chủng E. coli tái tổ hợp mang gen cry2A. 12
  15. 3.2.3.2. Nghiên cứu biểu hiện gen cry2A trong E. coli BL21 Biểu hiện sơ bộ gen cry2A Kết quả điện di protein tổng số trên gel SDS-PAGE cho thấy, dòng tế bào E. coli BL21 (DE3) mang vectơ biểu hiện pET-22b(+)-cry2A khi đƣợc cảm ứng cho phép tạo một vạch protein đậm có kích thƣớc khoảng 70 kDa, hoàn toàn trùng khớp với tính toán lý thuyết về kích thƣớc của protein Cry2A ở dạng dung hợp. Nhƣ vậy có thể kết luận rằng quá trình biểu hiện gen cry2A đã thành công. Kiểm tra Cry2A tái tổ hợp b ng Western blot Kết quả hình 3.17 cho thấy, protein dung hợp đƣợc thể hiện qua 1 băng với kích thƣớc đúng nhƣ tính toán (khoảng 70 kDa). Điều này có thể khẳng định, protein Cry2A đã đƣợc biểu hiện thành công trong hệ vector pET22b(+). Hình 3.17. Phân tích sự biểu hiện của protein Cry2A b ng kỹ thuật Western blot.M: Thang chuẩn protein (Biobasic); 1: Đối chứng dƣơng (Sigma); 2-4: Mẫu sau cảm ứng thu ở 1h, 2h, 5h; 5: Mẫu không mang gen. Để có thể tạo ra sản phẩm Cry2A có hoạt tính diệt côn trùng bộ Hai cánh, sản phẩm protein cần đƣợc tiếp tục xử lý và kiểm tra diệt côn trùng trên côn trùng thử nghiệm. Bảng 3.3. Thử hoạt tính sinh học của rCry2A và protein tinh thể từ B. thuringiensis với ấu trùng M. domestica Giới hạn LC50 tin cậy Côn trùng Protein LC50 (g) Thấp nhất Cao nhất M. 4D4 442,5 11,3 56,5 domestica MSS8.4 283,5 17,6 100 rCry2A 264,7 28,3 66,1 MSS8.4+rCry2A 268,6 27,8 59,3 Kết quả thử nghiệm hoạt tính ghi nhận sau 72 giờ cho thấy, protein tái tổ hợp có hoạt tính cao với côn trùng thử nghiệm (LC50 = 264,7 g). Đồng thời hoạt tính của protein Cry2A tự nhiên của chủng MSS8.4 (LC 50 = 283,5 µg) cũng cao hơn của chủng chuẩn 4D4 (LC50 = 442,5 g). Sự sai khác về khả năng diệt côn trùng có thể ở chủng MSS8.4 ngoài khả năng hình thành độc tố Cry2A còn có sự xuất hiện của độc tố Cry1A. 3.2.4. Nghiên cứu tối ƣu điều kiện biểu hiện gen 13
  16. 3.2.4.1. Nghiên cứu tối ưu nhiệt độ biểu hiện gen cry2A Tế bào E. coli BL21 đƣợc cấy lắc ở các điều kiện nhiệt độ khác nhau là: 28, 30, 37, 40 oC. Sau 4 giờ nuôi cấy, thu tế bào, điện di kiểm tra trên gel 12,6 % polyacrylamide. Kết quả cho thấy, ở nhiệt độ 37oC, tế bào biểu hiện cho băng protein đậm nhất. Do đó lựa nhiệt độ 37oC cho sự biểu hiện của rCry2A. 3.2.4.2. Nghiên cứu tối ưu nồng độ chất cảm ứng biểu hiện gen cry2A Lựa chọn nghiên cứu nồng độ chất cảm ứng IPTG lần lƣợt ở 0,1; 0,2; 0,5; 1; 1,5 mM. Kết quả biểu hiện cho thấy sự tổng hợp protein Cry2A tối ƣu nhất khi đƣợc cảm ứng ở 1mM. 3.2.4.3. Nghiên cứu tối ưu thời gian biểu hiện gen cry2A Cố định nhiệt độ cảm ứng là 37oC, nồng độ IPTG cảm ứng là 1 mM và khảo sát sự biểu hiện protein tái tổ hợp theo thời gian (1, 2, 3, 4, 5 giờ). Mẫu đƣợc xử lý và điện di kiểm tra trên gel polyacrylamide 12,6%. Kết quả, lƣợng protein tái tổ hợp tạo thành tăng theo thời gian, cao nhất tại thời điểm 4 và 5 giờ. Do đó, lựa chọn thời điểm 4 giờ để thu mẫu nhằm đảm bảo chất lƣợng sản phẩm và chi phí lên men. 3.2.5. Tinh chế protein tái tổ hợp b ng cột sắc kí ái lực Probond Nikel Resin Chủng tái tổ hợp đƣợc biểu hiện ở 37 oC, nồng độ chất cảm ứng IPTG 1 mM, thu sau 4 giờ. Sau đấy sinh khối tế bào đƣợc thu lại bằng ly tâm, xử lý và tinh sạch . Kết quả điện di SDS-PAGE cho thấy protein Cry2A tái tổ hợp đã đƣợc thu lại ở dạng tinh sạch, có kích thƣớc 70 kDa tƣơng đƣơng với kích thƣớc tính toán lý thuyết. 3.2.6. Hoạt tính diệt côn trùng bộ hai cánh của rCry2A và chủng MSS8.4 Bảng 3.4. Hoạt tính diệt côn trùng của protein tinh thể từ chủng MSS8.4 và protein tái tổ hợp rCry2A Côn trùng thử Protein LC50 (g)* Giới hạn LC50tin cậy nghiệm Thấp nhất Cao nhất M. domestica 4D4 442.5 11.3 56.5 MSS8.4 283.5 17.6 100 rCry2A 264.7 28.3 66.1 A. minimus 4D4 9.42 53.33 70 MSS8.4 7.34 56.67 83.33 rCry2A 7.03 70 93.33 A. aedes 4D4 19.05 6.67 63.33 MSS8.4 14.52 56.67 73.33 rCry2A 13.33 63.33 80 Cx. quinquefasciatus 4D4 19.05 36.67 46.67 14
  17. Côn trùng thử Protein LC50 (g)* Giới hạn LC50tin cậy nghiệm Thấp nhất Cao nhất MSS8.4 17.6 70 90 rCry2A 14.52 56.67 86.67 Hoạt tính diệt côn trùng của protein tinh thể đƣợc xác định dựa trên khả năng diệt ấu trùng của ấu trùng thử nghiệm bộ hai cánh gồm: M. domestica, A. minimus, A. aedes, Cx. quinquefasciatus. Thử nghiệm ở các nồng độ thay đổi từ 0,5 – 500 g/g, kết quả đƣợc xác định và phân tích bởi chƣơng trình Probit analysis. Kết quả thử nghiệm hoạt tính ghi nhận tại Bảng 3.4. Nhƣ vậy, protein tái tổ hợp Cry2A đã đƣợc biểu hiện thành công trong E. coli và protein tái tổ hợp có hoạt tính diệt ấu trùng bộ Hai cánh cao hơn protein tự nhiên, cũng nhƣ chủng chuẩn. Kết quả này cao hơn rất nhiều so với nghiên cứu của Misra và cộng sự, các phân đoạn protein Cry2Aa4 sau tinh sạch bằng sắc ký ái lực có LC50 trong khoảng 100-500 mg (Misra và cộng sự, 2002); Yilmaz và cộng sự (2017), tác giả chỉ ra rằng, Cry2Aa18 đƣợc biểu hiện có nguồn gốc từ cry2A của chủng B. thuringiensis SY49-1 có khả năng diệt ấu trùng C. pipiens (LC50= 630 g/ml). So với kết quả nghiên cứu của Reyaz và Arulsel (2016), protein tái tổ hợp sau tinh sạch Cry2AI1 có hoạt tính đối với Spodoptera litura và Helicoverpa armigera (LC50= 2,448 µg/ml) và Helicoverpa armigera (LC50= 3,374μg/ml) thì hoạt tính của protein rCry2A thấp hơn khá nhiều. 3.3. Lựa chọn môi trƣờng và tối ƣu lên men làm tăng khả năng hình thành protein tinh thể của chủng vi khuẩn MSS8.4từ bã bia 3.3.1. Xử lý bã bia làm nguyên liệu nuôi cấy vi khuẩn MSS8.4 3.3.1.1. Ảnh hưởng của các phương pháp tiền xử lý bã bia làm nguyên liệu lên men vi khuẩn MSS8.4 Khi sử dụng làm nguyên liệu lên men vi khuẩn MSS8.4, bã bia đƣợc nghiền nhỏ và đƣa về nồng độ chất rắn 2%. Thí nghiệm đƣợc thực hiện trong bình tam giác ở 30oC, thời gian 48 giờ, tốc độ lắc 200 vòng/phút, kết quả phân tích đƣợc trình bày ở bảng 3.5. Kết quả phân tíchcho thấy, sử dụng dịch thủy phân bằng phƣơng pháp axit cho mật độ TCC, SC và protein tinh thể cao nhất, mật độ tế bào đếm đƣợc đạt 4,9x108 CFU/ml; trong khi đó, thí nghiệm sử dụng bã bia vô trùng (TN3), TCC chỉ đạt 107 CFU/ml. Nhƣ vậy, tiền xử lý bã bia bằng phƣơng pháp axít nhiệt và kiềm nhiệt đã làm tăng hàm lƣợng các chất dinh dƣỡng trong môi trƣờng giúp vi khuẩn MSS8.4 sinh trƣởng tốt hơn.Kết quả nghiên cứu này cũng phù hợp với nhận định của Brar và các cộng sự, khi thủy phân các hợp chất hữu cơ ở nhiệt độ cao sẽ làm tăng giá trị dinh dƣỡng trong môi trƣờng. Do đó, mật độ tế bào, bào tử của vi khuẩn MSS8.4trên môi trƣờng bã bia thủy phân bằng 15
  18. phƣơng pháp axit nhiệt cao hơn so với trên các môi trƣờng khác (Brar và cộng sự, 2005). Khả năng sinh tinh thể độc của vi khuẩn MSS8.4 cũng có sự khác biệt rõ rệt ở các thí nghiệm khác nhau. thí nghiệm sử dụng bã bia vô trùng, sau 48 giờ lên men vi khuẩn MSS8.4, nồng độ delta-endotoxin đạt 319 mg/l. Trong khi đó, thí nghiệm sử dụng bã bia tiền xử lý bằng phƣơng pháp axít nhiệt nồng độ delta-endotoxin đạt 428 mg/l, cao gấp 1,3 lần so với thí nghiệm sử dụng bã bia vô trùng. Do đó, phƣơng pháp axit nhiệt đƣợc lựa chọn là phƣơng pháp tiền xử lý bã bia làm môi trƣờng nuôi cấy vi khuẩn MSS8.4. 3.3.1.2. Phân tích thành phần của dịch thủy phân bã bia bằng phương pháp axit nhiệt Để đánh giá hàm lƣợng các chất có trong dịch thủy phân bã bia, dịch thủy phân bã bia bằng phƣơng pháp axit nhiệt đƣợc gửi đi phân tích tại Phòng Phân tích chất lƣợng môi trƣờng - Viện Công nghệ môi trƣờng. Kết quả phân tích cho thấy, trong dịch thủy phân bã bia bằng phƣơng pháp axit nhiệt hàm lƣợng C, N (hai nguồn cơ chất quan trọng nhất trong sinh trƣởng của vi khuẩn) cao hơn hẳn so với dịch bã bia thủy phân bằng phƣơng pháp kiềm nhiệt hoặc chỉ vô trùng.Kết quả này hoàn toàn phù hợp với nhận định ở trên, khi cho rằng tác nhân axit ở điều kiện nhiệt độ cao đã giúp tăng khả năng phân hủy các hợp chất cao phân tử, làm tăng hàm lƣợng các hợp chất hữu cơ dễ hấp thu trong dịch thủy phân. Các nguyên tố khoáng là nhân tố không thể thiếu trong quá trình sinh trƣởng, phát triển của vi khuẩn nói chung và các chủng thuộc gen Bt nói riêng. Trong đó, các ion kim loại nhƣ Mg, Mn, Fe, Zn, Ca, v.v... có tác dụng điều tiết quan trọng đến sinh trƣởng, hình thành bào tử cũng nhƣ sinh tổng hợp protein tinh thể diệt côn trùng. Do vậy, trong môi trƣờng tổng hợp lên men vi khuẩn thƣờng đƣợc bổ sung thêm một số muối khoáng với nồng độ nhƣ sau: 0,3% MgSO4.7H2O; 0,02%o MnSO4.7H2O; 0,02%o FeSO4.7H2O; 0,2%o ZnSO4.7H2O và 1,0%o CaCO3(Ngô Đình Bính, 2000). Xét theo nhu cầu khoáng này của vi khuẩn Bt thì không có nguyên tố nào ở cả ba thí nghiệp đáp ứng đủ nhu cầu khoáng. Do vậy, phải bổ sung thêm khoáng vào dịch thủy phân bã bia để cải thiện chất lƣợng môi trƣờng lên men cho vi khuẩn MSS8.4. Tuy nhiên, theo nghiên cứu của Ozkan và các cộng sự: ở nồng độ 10 -6M, Mn là yếu tố chủ chốt tác động đến sự sinh tổng hợp độc tính của vi khuẩn Bt mà không ảnh hƣởng tới quá trình khác của tế bào. Trong dịch thủy phân bã bia bằng phƣơng pháp axit nhiệt, Mn có nồng độ 0,136 mg/l (2,7x10 -6M/l) là nồng độ nằm trong khoảng nông độ phù hợp cho lên men vi khuẩn Bt thu độc tố delta endotoxin(Ozkan và cộng sự, 2003). Theo nghiên cứu của Içgen và các cộng sự, sự sinh trƣởng, hình thành bào tử và sinh tổng hợp protein tinh thể của vi khuẩn Btk không chỉ phụ thuộc vào 16
  19. các yếu tố dinh dƣỡng cacbon, nito mà còn chịu tác động rất lớn từ các nhân tố khoáng. Cụ thể, khi bổ sung Mg ở nồng độ từ 8x10 -5M đến 4x10-3M mật độ tế bào và nồng độ protein tinh thể tăng mạnh (Içgen và cộng sự, 2002). Theo kết quả phân tích, nồng độ của Mg trong dịch thủy phân bã bia bằng phƣơng pháp axit nhiệt là 12 mg/l (2,9x10-3M), đây là nồng độ Mg nằm trong khoảng thích hợp cho sự phát triển và sinh độc tố của vi khuẩn Bt theo nhƣ nghiên cứu của Içgen. 3.3.1.3.Xác định nồng độ bã bia phù hợp làm môi trường lên men vi khuẩn MSS8.4 Các thí nghiệm lên men vi khuẩn MSS8.4 sử dụng bã bia đƣợc thực hiện ở các nồng độ nhƣ sau: 1%TS; 1,5%TS; 2%TS; 2,5%TS; 3%TS; 3,5%TS. Các kết quả nghiên cứu cho thấy: t lệ % chất khô của bã bia nằm trong khoảng từ 2 – 3là phù hợp cho sự phát triển của vi khuẩn Bt. nồng độ thấp (1%TS) mật độ vi khuẩn trong mẫu sau 48 giờ lên men chỉ đạt 2,9x10 7CFU/ml, trong khi đó ở nồng độ 2,0 – 3,0%TS mật độ tế bào sau 48 giờ lên men đạt trên 108CFU/ml. Trong thí nghiệm 6 khi tăng nồng độ bã bia lên 3,5%, mật độ tế bào thu đƣợc sau 48 giờ lên men không cao chỉ đạt 107CFU/ml. Protein tinh thể đƣợc sinh ra đồng thời với quá trình hình thành bào tử và là sản phẩm mong muốn trong quá trình lên men vi khuẩn MSS8.4. Do vậy, đây là một chỉ tiêu quyết định đến chất lƣợng sản phẩm. Kết quả thí nghiệm trong bảng 3.6 cho thấy ở nồng độ bã bia 2,5% nồng độ protein tinh thể đạt đƣợc là cao nhất. Nhƣ vậy, xét về mặt tổng thể nồng độ 2,5%TS là phù hợp nhất cho lên men MSS8.4 thu độc tố diệt ấu trùng ruồi. Nồng độ 2,5%TS sẽ đƣợc sử dụng cho tất cả các nghiên cứu về sau. 3.3.2. Đánh giá tác động độc lập của các yếu tố dinh dƣỡng bổ sung vào dịch thủy phân bã bia đến sinh trƣởng và sinh tinh thể độc của vi khuẩn MSS8.4. 3.3.2.1. Xác định nguồn dinh dưỡng bổ sung vào môi trường bã bia Thí nghiệm đƣợc thực hiện trong bình tam giác, thời gian lên men 48 giờ, tốc độ lắc 200 vòng/phút. Xác định mật độ tế bào, bào tử và nồng độ protein tinh thể sau 48 giờ lên men. Kết quả đánh giá ảnh hƣởng của các hợp chất hữu cơ bổ sung vào dịch thủy phân bã bia cho thấy cám gạo và bột đậu tƣơng là hai yếu tố có tác động tích cực đến sinh trƣởng cũng nhƣ sự tạo thành tinh thể độc của chủng vi khuẩn MSS8.4. Theo nghiên cứu của Nguyễn Thị Hoài Trâm và các cộng sự thì bột đậu tƣơng là nguồn dinh dƣỡng tốt nhất cho sinh trƣởng của vi khuẩn Bt sinh độc tố diệt sâu (Nguyễn Hoài Trâm, 2004). Kết quả này cũng phù hợp với kết quả công bố của Nguyễn Thị Hòa và các cộng sự thì khi bổ sung cám gạo và bột đậu tƣơng vào dịch thủy phân bùn thải sinh học làm môi trƣờng lên men vi khuẩn Btk thu độc tố diệt trừ sâu (Hoa và cộng sự, 2014). Trong hai nguồn dinh 17
  20. dƣỡng cám gạo và bột đậu tƣơng thì bột đậu tƣơng có khả năng tan tốt hơn, do vậy, bột đậu tƣơng đƣợc chọn làm nguồn dinh dƣỡng bổ sung vào dịch thủy phân bã bia. Khi xem xét hàm lƣợng protein tinh thể trong dịch lên men MSS8.4 sau 48 giờ nuôi cấy cho thấy: có một sự khác biệt rõ rệt khi bổ sung thêm muối MgSO4.7H2O và MnSO4 vào dịch thủy phân bã bia. hai thí nghiệm có bổ sung 0,5 g/l MgSO4.7H2O và 0,05 g/l MnSO4 hàm lƣợng protein tinh thể thu đƣợc sau 48 giờ lên men tăng khoảng 10% so với thí nghiệm đối chứng là dịch thủy phân bã bia, hàm lƣợng deta endotoxin lần lƣợt đạt 469 mg/lít và 461 mg/lít. Kết quả nghiên cứu này hoàn toàn phù hợp với kết quả nghiên cứu của Braun năm 2000, Icgen và các cộng sự khi nghiên cứu về vai trò của Mg2+ trong sinh trƣởng và sinh tổng hợp protein tinh thể. Các tác giả này đã chỉ ra rằng sự thiếu hụt của Mg2+ trong môi trƣờng lên men sẽ làm giảm khả năng sinh trƣởng, hình thành bào tử trong dịch lên men, nhƣng ảnh hƣởng lớn nhất phát hiện đƣợc là giảm khả năng tổng hợp độc tố protein tinh thể. Mg 2+ là trung tâm điều khiển hoạt động của enzym, sự có mặt của Mg sẽ tác động đến quá trình hình thành bào tử và sinh tổng hợp protein tinh thể (Braun S, 2000; Icgenvà cộng sự, 2002). Kết quả nghiên cứu trên bảng 3.9 cho thấy Mn2+ là một trong hai yếu tố ảnh hƣởng mạnh đến khả năng sinh tổng hợp protein tinh thể. Kết quả này cũng phù hợp với nhận định của Ozkan và các công sự khi cho rằng Mn là yếu tố chủ trốt tác động đến quá trình sinh tổng hợp protein tinh thể của vi khuẩn Bt mà không ảnh hƣởng tới quá trình khác của tế bào (Ozkan và cộng sự, 2003). Theo nghiên cứu của Subbiah và các cộng sự khi nghiên cứu sản xuất chế phẩm diệt muỗi từ vi khuẩn B. thuringiensis subsp. israelensis việc bổ sung Mn2+ vào môi trƣờng dinh dƣỡng làm từ lông vũ đã làm tăng đáng kể hàm lƣợng protein tinh thể trong dịch canh trƣờng lên men Bti (Subbiah và cộng sự, 2012). Dựa vào các kết quả nghiên cứu ở trên, bột đậu tƣơng, MgSO 4.7H2O và MnSO4 là các nhân tố đƣợc lựu chọn làm nhân tố dinh dƣỡng để hoàn thiện môi trƣờng lên men vi khuẩn MSS8.4 trên nền môi trƣờng cơ sở từ dịch thủy phân bã bia. 3.3.2.2. Đánh giá tác động độc lập của yếu tố đã chọn đến sinh trưởng và sinh tổng hợp detlta endotoxin của MSS8.4 Sau khi đánh giá tác động độc lập của các yếu tố lựa chọn đến sinh trƣởng, hình thành bào tử và sinh tổng hợp protein tinh thể cho thấy, nồng độ mangan từ 0 – 0,1 g/l, magie từ 0 – 1,0 g/l; bột đậu tƣơng từ 0 - 5 g/l có ảnh hƣởng mạnh đến sinh trƣởng, sinh tổng hợp tinh thể protein tinh thể của MSS8.4 khi bổ sung vào dịch thủy phân bã bia. 3.3.3. Tối ƣu hóa môi trƣờng lên men cho vi khuẩn MSS8.4 từ nguồn bã bia 18
nguon tai.lieu . vn